| KB10 |
mir-67(n4899) III. |
C. elegans |
MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| KB11 |
mir-83(n4638) IV. |
C. elegans |
MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| KB12 |
mir-67(n4899) III; mir-83(n4638) IV. |
C. elegans |
Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638). |
| KB2 |
glh-2(um2) I. |
C. elegans |
|
| KB3 |
kgb-1(um3) IV. |
C. elegans |
Temperature sensitive sterile at 26C, with EMO oocytes. Grows at 15C or 20C. |
| KB4 |
glh-4(gk225) glh-1(ok439) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele. |
| KB6 |
rle-1(cxTi510) III. |
C. elegans |
Slowed development. Increased life span. Decreased embyronic viability. Decreased brood sizes. |
| KB7 |
kgb-1(um3) kgb-2(km16) IV. |
C. elegans |
Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)] |
