Laboratory Information

NameKB View on WormBase
Allele designationum
HeadBennett, Karen
InstitutionUniversity of Missouri, Columbia
Address Molecular Microbiology & Immunology University of Missouri School of Medicine M607 Medical Sciences Building 1 Hospital Drive Columbia, MO 65203

Website http://mmi.missouri.edu/karen/klb.php
Gene classes csn  glh  kgb  pan  rle  zyx 

Strains contributed by this laboratory

Strain Genotype Species Description
KB10 mir-67(n4899) III. C. elegans MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KB11 mir-83(n4638) IV. C. elegans MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KB12 mir-67(n4899) III; mir-83(n4638) IV. C. elegans Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).
KB2 glh-2(um2) I. C. elegans
KB3 kgb-1(um3) IV. C. elegans Temperature sensitive sterile at 26C, with EMO oocytes. Grows at 15C or 20C.
KB4 glh-4(gk225) glh-1(ok439) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele.
KB6 rle-1(cxTi510) III. C. elegans Slowed development. Increased life span. Decreased embyronic viability. Decreased brood sizes.
KB7 kgb-1(um3) kgb-2(km16) IV. C. elegans Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
um2 Allele deletion
um3 Allele deletion