Species Information: C. elegans

Name C. elegans
NCBI Taxonomy ID

C. elegans strains available at the CGC

Strain Genotype Description
PS9030 syIs742; syIs300. syIs742 [Y41C4A.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9547 syIs812; syIs337. syIs812 [srj-26p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9550 syIs815; syIs337. syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9034 syIs686. syIs686 [gpa-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASI neurons.
PS8769 syIs695. syIs695 [trx-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons.
PS9441 syIs794; syIs337. syIs794 [F47D2.11::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9542 syIs807; syIs337. syIs807 [pps-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS7829 syIs493 I. syIs493 [sra-9p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASK neurons.
PS8293 syIs564. syIs564 [odr-10p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWA neurons.
PS8565 syIs666; syIs300. syIs666 [str-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8496 syIs627; syIs300. syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9435 syIs788. syIs788 [srt-28p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-OFF neuron.
PS9445 syIs798. syIs798 [srt-47p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-ON neuron.
PS8562 syIs663; syIs300. syIs663 [gcy-33p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for BAG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9443 syIs796; syIs300. syIs796 [F35D11.1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, F09E10.7p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for CEP neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9663 syEx1708; syIs300. syEx1708 [dat-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for dopaminergic neurons (CEP, ADE, PDE). syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9235 syIs768; syIs300. syIs768 [aqp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL1 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8872 syIs716; syIs300. syIs716 [klp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL2 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9551 syIs816; syIs300. syIs816 [ocr-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for OLQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8849 syIs710; syIs300. syIs710 [srg-13p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8846 syIs707; syIs300. syIs707 [osm-10p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, srb-6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for PHA and PHB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9534 syIs799; syIs300. syIs799 [F58F6.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8648 syIs678; syIs300. syIs678 [flp-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9664 syIs300; syEx1709. syEx1709 [arrd-16p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. cGAL driver for URY neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9665 syIs300; syEx1711. syEx1711[nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
PS9666 syIs300; syEx1712. syEx1712[T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
PS9668 syIs300; syEx1714. syEx1714 [flp-11p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, seb-3p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for OLL neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
RG3307 +/nT1[umnIs49] IV; xpo-1(ve807[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve807 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCAAACTTATAGTTTTCTTTTTTCAGGTCT ; Right flanking sequence: TGGTGTGACCTGGTTTATTTTCAATCGAAA. sgRNA #1: CGACATTCTCAAAGAATTAC; sgRNA #2: AGATGAGGATATGCGTTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3308 C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3310 C28F5.4(ve810[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2762 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTCTTTCGTGATTCTTTTTGAAATGCCA ; Right flanking sequence: TTCCTAAGAAGAGCATATGCTCGCAGAAGT. sgRNA #1: GGACGCAATAAAGAAGTGCG; sgRNA #2: CTGCCAAATATCCGTCAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3311 fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3312 gdh-1(ve812[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve812 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTTAATTACAAAATATTTTATTTTCAGGTA ; Right flanking sequence: GTACCCACTTCTCACTCATCTCATGGCTCT. sgRNA #1: ATGTTGAGCACTCTTTCCAG; sgRNA #2: TTATGTGAAGGTGAATCCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3313 arrd-4(ve813[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAACGTTGACCTTCAAAGCAGTAGCTTC ; Right flanking sequence: cggcagtttgctgcaacttattgcccaacc. sgRNA #3: TCCAATGCAGTTGCTTGAGT; sgRNA #4: acctcgtcgtttcagccaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3314 asp-19(ve814[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAAAACCTAGACCAACAATGGTTGCAATT ; Right flanking sequence: AGTGCATCTCATGAAAAAAATAGAGACGGG. sgRNA #1: ACCATTACAAAGCAAGAGCT; sgRNA #2: TGCTGTTTTGTAGCTCACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
OH17294 npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH18062 nlp-11(syb4759[nlp-11::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX3426 ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX2934 ceh-37(syb2933[loxP]) ceh-36(syb2934[ceh36::loxP::GFP]) X. CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17963 otIs879. otIs879 [sri-1p::NLS::GFP + pha-1(+)]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3212 flp-21(syb3212 [flp-21::T2A::3×NLS::GFP]) V. CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17766 ins-3(syb5421[ins-3::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17767 ins-6(syb5463[ins-6::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
OH17768 ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17826 ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH16866 otIs810. otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
RG3315 gpd-4(ve815[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTCATTCAAGTTTTCTTACAGACTCAAA ; Right flanking sequence: TGGAGCATGCATTTCGCTCAACCCGAACTT. sgRNA #1: AAAATGTCGAAAGCCAACGT; sgRNA #2: GTATCGAAAATGGACGAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3316 lrp-1(ve816[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest, Mlt. Deletion of 15775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve816 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTGGTTGTCAAGCAGGTTGCCATCCATCA ; Right flanking sequence: CACGTCAGCATCTGCAATGTCACCAAACAG. sgRNA #1: CACGTACATTCACCTCCATG; sgRNA #2: GATGGCTGATCATTTGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3317 F44E5.5(ve817[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2259 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGAAAAAGAAAGAGGGAGACAGAGTG ; Right flanking sequence: AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA #1: TCTAGAAGATGTTACGGGAA; sgRNA #2: AACAGGCATACATTAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3318 +/mT1 [umnIs52] II; prx-10&wrs-2(ve818[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest/sterile. Deletion of 3348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae/sterile adults (ve818 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCAGCGAAGAGATGAAGAGTATATTGAAGA ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: TATTACAGAAAGATTGAGCA; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3319 +/mT1 [umnIs52] II; wrs-2(ve819[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve819 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGTTGATCAACACGCTATTTCACTTGGACC ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: ACTTCCAGCAAATGAGGTTG; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.