| MH4176 |
ain-1(ku425) X. |
Superficially wild-type. Identified in a screen for suppressors of the Multivulva (Muv) phenotype in lin-31 loss-of-function (lf) mutants. Reference: Ding L, et al. Mol Cell. 2005 Aug 19;19(4):437-47. PMID: 16109369. |
| RG3309 |
egrh-2(ve809[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 5538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCTATCGGTTCGCAAATGTCATTACCG ; Right flanking sequence: cccACTTTTAATCTGAAATTTTGTATAAAA. sgRNA #1: GTGTGTCGGAGGAAGAAACA; sgRNA #2: aaattgctttaatgcctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| OH15338 |
ceh-32(ok343) V; otEx7146. |
otEx7146 [ceh-32(+) fosmid WRM0637dA10 + myo-2p::RFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH16543 |
unc-39(ok2137) V; otEx7581. |
otEx7581 [unc-39(+) fosmid WRM0636cG07 + inx-6(prom18)::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17368 |
otIs854. |
otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17502 |
otIs867. |
otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| OH17657 |
unc-39(syb4537ot1193[unc-39p(bs_del)::unc-39::gfp]) V. |
ot1193 is a CRISPR-engineered mutation of a small unc-39 auto-regulatory region containing a cluster of several predicted homeodomain binding sites in the endogenously-tagged unc-39(syb4537) reporter strain. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX3278 |
flp-19(syb3278 [flp-19::T2A::3xNLS::GFP]) X. |
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX4374 |
flp-32(syb4374[flp-32::SL2::gfp::H2B]) X. |
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313. |
| PHX4512 |
nlp-69(syb4512[nlp-69::SL2::gfp::H2B]) V. |
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX4537 |
unc-39(syb4537[unc-39::gfp]) V. |
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. |
| PHX3229 |
flp-9(syb3229[flp-9::T2A::3xNLS::GFP]) IV. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| OH16335 |
ceh-34(ot1014) V; otEx7476. |
otEx7476 [ceh-34(fosmid) + myo-3p::mCherry]. Pick mCherry+ to maintain. ot1014 is a CRISPR/Cas9-engineered allele removing the entire ceh-34 locus. ot1014 homozygotes arrest as L1 larvae. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH15439 |
ceh-34(ot903[ceh-34::mNG::3xFLAG::AID*]) V. |
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID* tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16563 |
ceh-45(ot1065) I. |
ot1065 is a CRISPR/Cas9-engineered allele removing the entire ceh-45 locus. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4513 |
flp-5(syb4513[flp-5::SL2::GFP::H2B]) X. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425. |
| PHX4861 |
gpla-1(syb4861[flr-2::SL2::GFP::H2B]) V. |
CRISPR/Cas9-engineered reporter allele. gpla-1 formerly known as flr-2. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4895 |
htrl-1(syb4895[htrl-1::SL2::GFP::H2B]) V. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4677 |
kin-36(syb4677[GFP::HIS::SL2::kin-36]) IV. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4763 |
rig-3(syb4763[rig-3::SL2::GFP::H2B]) X. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4729 |
rig-6(syb4729[rig-6::SL2::GFP::H2B]) II. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4502 |
ser-7(syb4502[ser-7::SL2::GFP::H2B]) X. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| PHX4421 |
trh-1(syb4421[trh-1::SL2::GFP::H2B]) IV. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425. |
| PHX4453 |
trhr-1(syb4453[trhr-1::SL2::GFP::H2B]) I. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425. |
| PHX4491 |
unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV. |
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16816 |
otIs809. |
otIs809 [glr-7::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH15487 |
otIs695. |
otIs695 [nlp-3p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH15655 |
otIs711. |
otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16003 |
otIs742. |
otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH16700 |
otIs785. |
otIs785 [ceh-34p::GFP::CLA-1 + ceh-34p::TagRFP + rol-6(su1006)]. Rollers. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650 |
| OH18012 |
pha-1(e2123) III; otEx7948. |
otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| AX7884 |
pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. |
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)
encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.
Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. |
| PS8843 |
syIs704; syIs300. |
syIs704 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + mbr-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AIM neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8290 |
syIs561. |
syIs561 [ttx-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AIY neurons. |
| PS8409 |
syIs569; syIs300 |
syIs569 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-7p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AVG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8132 |
syIs532; syIs300 |
syIs532 [hlh-34p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVH neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8288 |
syIs559; syIs300 |
syIs559 [flp-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVK neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS9031 |
syIs743; syIs300. |
syIs743 [pks-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for CAN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS7155 |
syIs392. |
syIs392 [unc-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for Cholinergic neurons. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS9232 |
syIs751; syIs300. |
syIs751 [ttr-39p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DD and VD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8131 |
syIs530; syIs300 |
syIs530 [ceh-63p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DVC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8416 |
syIs580; syIs300 |
syIs580 [nlp-12p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DVA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8453 |
syIs534; syIs300 |
syIs534 [flp-20p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + inx-11p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for gland cell. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS7521 |
syIs483 X; syIs300. |
syIs483 [unc-17p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + ceh-19p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] X. Split cGAL driver for MC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8661 |
syIs691; syIs300. |
syIs691 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + grl-2p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for MCM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8660 |
syIs690; syIs300 |
syIs690 [tph-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR +pdf-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. [NOTE: Pick animals with RFP+ coelomocytes to maintain. Array appears to be lost or silenced in some animals.] Split cGAL driver for NSM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8282 |
syIs554; syIs300 |
syIs554 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-20p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for PVC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS8839 |
syIs700; syIs300 |
syIs700 [nlp-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for PVQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
| PS8279 |
syIs537; syIs300 |
syIs537 [glr-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148. |
| PS9229 |
syIs748; syIs300. |
syIs748 [tbh-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
