| PS8997 |
flp-1(sy1599) IV. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-1;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GACTCTGCTCTACCAAGTAGGGTTATTACTCCTTGT
Right flanking sequence: GGCAGCTACTTATAAGgtttctttcttgatttaat
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTTATAAGTAGCTGCCACA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS9048 |
msp-40(sy1604) II. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-40;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CAACACCCCGGATGGAGCTGCTAAGCAATTCCGCCG
Right flanking sequence: TGAGTGGTTCCAAGGAGACGGCATGGTTCGTCGTAAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCTTGGAACCACTCACGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| COP1622 |
nas-38(knu568) X. |
Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| COP1635 |
nas-38(knu579 ok3407) X. |
Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1110 |
unc-119(ed3) III; goeIs257. |
goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1549 |
goeIs326. |
goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1896 |
goeIs388. |
goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1897 |
goeIs397. |
goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1900 |
goeIs408. |
goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1901 |
goeIs407. |
goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1902 |
goeIs409. |
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1907 |
goeIs410. |
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1911 |
goeIs411. |
goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1912 |
goeIs412. |
goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1961 |
goeIs431. |
goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR2317 |
nlp-8(syb762) IV. |
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| PHX1446 |
nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. |
Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| PHX293 |
nas-38(syb293) X. |
Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| NC3738 |
wdIs132; uIs152. |
wdIs132 [gcy-35::GFP]. uIs152 [mec-3::RFP]. AVM neurons are labeled with GFP and RFP. Can be used to isolate AVM by FACS. wdIs132 arose from spontaneous integration of kyEx1162 [gcy-35::GFP]. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| BOX163 |
erm-1(mib9[erm-1[T544D]]) I. |
Homozygous viable. Modification of endogenous erm-1 locus mimics ERM-1(T544) phosphorylation. Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975 |
| BOX165 |
erm-1(mib10[erm-1[T544A]]) I. |
Homozygous viable. Modification of endogenous erm-1 locus mimics non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975 |
| BOX213 |
erm-1(mib15[erm-1::eGFP]) I. |
Endogenous erm-1 locus tagged with eGFP. Homozygous viable, partially functional endogenous erm-1 tag. erm-1::GFP animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. |
| BOX215 |
erm-1(mib16[erm-1[T544D]::GFP]) I. |
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic ERM-1(T544) phosphorylation. Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975 |
| BOX218 |
erm-1(mib19[erm-1[T544A]::GFP]) I. |
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975 |
| XE2660 |
wpIs40 V; ynIs50. |
wpIs40 [unc-47p::mCherry] V. ynIs50 [flp-22p::GFP]. AVL neurons are labeled with GFP and mCherry. Can be used to isolate AVL by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| RG3193 |
cct-8(ve693[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. |
Homozygous larval lethal. Deletion of 5958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve693 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CACGTGGTTTTGGTCCTCCAGTCGCCTGCT ; Right flanking sequence: CGGTTCCTTTGAAGTGCTGAGCTCCTTCCT. sgRNA #1: TCAGATTATTATGTCAAAGC; sgRNA #2: GCACTTCAAAGGAACCGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3195 |
frpr-12(ve695[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 2237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttagttccagtgagagaaaaatatcatgaa ; Right flanking sequence: TGGTTATACATCAATCAAAAGCATATGAga. sgRNA #1: ataacaacaataaggaATGA; sgRNA #2: ATCAAATCAACGTCTCATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3196 |
csn-1(ve696[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. |
Homozygous sterile deletion as unbalanced heterozygote. Deletion of 5448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Pick viable fertile GFP+ animals to maintain. Heterozygotes are wild-type dim GFP+ and segregate wild-type dim GFP+, bright GFP+ sterile adults (ve696 homozygotes), and non-GFP wild-type homozygotes. Left flanking Sequence: cgcataaaggttttccggcatcgaggtctc ; Right flanking sequence: tggaaaaaatgaatctcgagggattttgag. sgRNA #1: accacgattaccgtatctgg; sgRNA #2: GCTGGGATTGTTGACTGTTc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details.
doi.org/10.1038/s41598-021-97764-9 |
| CGC141 |
mir-1821(umn48[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) V. |
mir-1821 pre-miRNA deletion allele in which mir-1821 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] |
| CGC142 |
mir-359(umn49[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272]) V. |
mir-359 pre-miRNA deletion allele in which mir-359 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] |
| TMD67 |
mikSi1 II; ltIs38. |
mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256. |
| TMD119 |
pcmd-1(syb486[gfp::pcmd-1]) I. |
GFP tag inserted into endogenous pcmd-1 locus. Reference: Erpf AC, et al. Curr Biol. 2019 Apr 22;29(8):1324-1336.e6.
doi: 10.1016/j.cub.2019.03.029. PMID: 30982652 |
| NC3792 |
ynIs37 III; ufIs26. |
ynIs37 [flp-13p::GFP] III. ufIs26 [unc-4p::mCherry + lin-15(+)]. I5 neurons are labeled with GFP and RFP. Can be used to isolate I5 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
| RG3197 |
Y54G2A.75(ve697[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. |
Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3198 |
+/mT1 [umnIs52] II; ZK686.3(ve698[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve698 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctttggagaaggggaaaacaccttctagt ; Right flanking sequence: GACGGCGAGCAGCATgaagaacagtaatac. sgRNA #1: gggaaaacaccttctagttt; sgRNA #2: CTGCTGAGCCGACTCGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3199 |
ZK792.5(ve699[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3088 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve699 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccctttttgtttgccaagattatcagatga ; Right flanking sequence: TGTGGCTTCTTCTCAGCATCAGCAGCAGCA. sgRNA #1: gccaagattatcagatgatc; sgRNA #2: AAATTGTTTCTCTCCTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3200 |
ZK809.3(ve700[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 863 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve700 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cgaatttcaggctcaaATGGGTAACCAGTA ; Right flanking sequence: TGTTGGAGAGACAAAACGACCGTGGTAAtc. sgRNA #1: TGCGTTCTGGTTTCACATAC; sgRNA #2: GTTTTGTCTCTCCAACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| ZH2486 |
enIs74 II; unc-76(e911) V. |
enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066. |
| KU801 |
klc-2(km11) V. |
Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606 |
| CZ23908 |
rab-8(tm2526) I; muIs32 II. |
muIs32 [mec-7p::GFP + lin-15(+)]. Homozygous viable. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420 |
| CZ18401 |
rpl-29(tm3555) IV. |
Homozygous viable Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| RG3201 |
+/nT1[umnIs49] IV; ZK856.11(ve701[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Mid-larval arrest, arrested larvae are somewhat Dpy. Deletion of 980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested somewhat Dpy larvae (ve701 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aggcagcaggcgcataaacaggaaagtaaa ; Right flanking sequence: tcaggtttaaaaaaaattgagttttaagtt. sgRNA #1: cataaacaggaaagtaaagg; sgRNA #2: GTAGCAGCAGACATgatttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3202 |
+/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3203 |
C17H11.1(ve703[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 7049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aacgcactggaaatttaatagttgtttgcg ; Right flanking sequence: ataaatgtattataaatatggacaatgttt. sgRNA #1: gtgaatccccacagagtact; sgRNA #2: gcacaataaattaagaagta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3204 |
lips-16(ve704[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1780 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGGTATTATATAGTTCCCTTTTGTTGAGTT ; Right flanking sequence: AATATTTTATTTCAATAGACTATCAATCCG. sgRNA #1: GTGAAGGTACTGAAATTGAC; sgRNA #2: GACATCAAACTATGTATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3205 |
F19C7.2(ve705[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2784 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattaataggactttccaaaaaattgttga ; Right flanking sequence: AGgtgagtttttgcgtcttgataaaaaatc. sgRNA #1: actgaaatcaaattggtctt; sgRNA #2: GCACAGGCTATTAGGACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3206 |
ZK973.11(ve706[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous Unc. Deletion of 2352 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gacagtatatattagcactttgagcatttt ; Right flanking sequence: tggtgcagcacggctcggcgagcaccgctt. sgRNA #1: gagcaaaaatcttcgaataa; sgRNA #2: atcaatattcacggaacagt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3207 |
frpr-11(ve707[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 2244 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: catgttctctcatttatatgaaaatttcca ; Right flanking sequence: AGGAAGACAGAATACAAAAACTACCCGATC. sgRNA #1: acggaaagaatatagcttta; sgRNA #2: GAATTAACAGTATCAAGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3208 |
F19C7.4(ve708[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2275 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtgttaaacggctataaaaaattcgtcca ; Right flanking sequence: aggttcatttaagaatgcctcttattcaaa. sgRNA #1: acaactatgggacaacgtag; sgRNA #2: CTATTAGGCAGCATTCAGgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3209 |
F28E10.5(ve709[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2743 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccatttttatacaaatttttcaataaacg ; Right flanking sequence: gacaactattttctcatgatttaagttttt. sgRNA #1: aaaaatgttcagaatctctc; sgRNA #2: catgagtagtgcacaacggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
