| VC4823 |
Y39B6A.27(gk5891[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. |
Homozygous viable. Deletion of 3347 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAACTTTTATGTTCGGCAATGCTCGGATTG. Right flanking sequence: TGGAACGAAAAATCACTGAGCAGAAAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4824 |
C52A11.3(gk5892[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. |
Homozygous viable. Deletion of 1111 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AAAAACAATGAAATATAATGTTAATTGGAG. Right flanking sequence: AAAATTCAAATCTCGCATTGTAACGGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4825 |
plep-1(gk5893[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. |
Homozygous viable. Deletion of 2115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AGAAACTGCTGCAGAAGATTTTTGAAACCT. Right flanking sequence: TGGAGCAAAAAAGCAGCTGACCGTGTTGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4826 |
T26C5.3(gk5894[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. |
Homozygous viable. Deletion of 3251 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TACCTGTGTTCTTTTTGTGTGGCGCCTGCT. Right flanking sequence: TGGAATCATCGACCTAGCAGGTAGATTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4827 |
F40F9.3(gk5895[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. |
Homozygous viable. Deletion of 1399 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GTTTTATGAGTGCTATCAGCGAAAAAATAT. Right flanking sequence: AGGAAAATAATATATTGAACTTCAATGCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4828 |
Y92H12BL.1(gk5896[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. |
Homozygous viable. Deletion of 11570 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GGTGTTAAGCAGATTGATCGAATTGTTGAA. Right flanking sequence: GTTTATGGTAGCGGTATTGATTTTTCTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4829 |
hum-10(gk5897[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. |
Homozygous viable. Deletion of 5450 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTTCAAAGTTTCCTTTTTCAGGAATTTGTG. Right flanking sequence: AGGGTGGCAGGGCATTGATCTGTGAAAACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4830 |
txbp-3(gk5898[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. |
Homozygous viable. Deletion of 1023 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GTTTGAATGTGAACGGAACAAATGAGATTG. Right flanking sequence: TGGTCTCCATTTTTCTTACACTATCTCATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4833 |
ZK1236.9(gk5901[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. |
Homozygous viable. Deletion of 2713 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GCCTAAAATATTCGAAATAAAAGTTAAATA. Right flanking sequence: TGGGAATCAGAATAAAACGAGGAAACGACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4834 |
C17B7.8(gk5902[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. |
Homozygous viable. Deletion of 3647 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ACTGGTAAATTGATTTTCTTGATCTAACCC. Right flanking sequence: TGGAGCAACCTTGTTCTTCAAATGTCTGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4835 |
T22A3.6(gk5903[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. |
Homozygous viable. Deletion of 2609 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GTATTTAGGCATAGTATAGGCACACTGGTA. Right flanking sequence: ATGTTCTGCGTCTCTCGTCAATGCACGCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4836 |
taco-1(gk5904[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. |
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2838 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAATTTTCGATTAAAAACCATGAATATCCA. Right flanking sequence: GGGTGAAAAATAACGAGAAACACGATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4837 |
txt-1(gk5905[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. |
Homozygous viable. Deletion of 1431 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CCACGTCCAGTTTTTTAATAGATCACGCCA. Right flanking sequence: TGGCTTTTCTTTTTCTGTTTCCGTTTCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC2558 |
R02E12.4(ok3304) X. |
Homozygous viable, carrying a deletion in R02E12.4. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3131 |
Y53G8AR.6(gk3515) III. |
Homozygous viable, carrying a deletion in Y53G8AR.6. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3225 |
T19B4.3(gk3582) dhhc-11(gk3068) I; twk-4(gk3583) II; F26D11.2(gk3584) gkDf88 V. |
Homozygous viable, carrying deletions in T19B4.3, dhhc-11, twk-4 and F26D11.2, plus a large multi-gene deletion on LG V. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3289 |
sdhd-1&ilkp-2(ok1222) II. |
Homozygous viable, carrying a deletion affecting sdhd-1 and ilkp-2. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3326 |
W02B12.12(gk3362) II. |
Homozygous viable, carrying a deletion in W02B12.12. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3332 |
mpc-1(gk3500) III. |
Homozygous viable, carrying a deletion in mpc-1. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3335 |
srz-96(gk3364) V. |
Homozygous viable, carrying a deletion in srz-96. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3381 |
srx-68(gk3547) nhr-195(gk3359) V. |
Homozygous viable, carrying deletions in srx-68 and nhr-195. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3408 |
lys-6(ok2151) IV. |
Homozygous viable, carrying a deletion in lys-6. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| PS7734 |
T05C3.2(sy1080) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA
Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC
inserted sequence between the two flanking sequence (STOP-In casette):
GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7783 |
K03E5.2(sy1086) I. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG
Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7837 |
aex-2(sy1078) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG
Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7858 |
C01B10.10(sy1114) IV. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT
Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7898 |
C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. |
Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7922 |
C01B10.4(sy1131) IV. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7951 |
adm-4(sy1161) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7953 |
C23H4.2(sy1163) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7960 |
C04G6.4(sy1165) II. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS7962 |
ttc-36(sy1167) II. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8008 |
ZC376.2(sy1170) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8012 |
Y55F3BL.4(sy1174) IV. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55F3BL.4;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GAAGACGACGGATTCACCCTGGTCACTGGTAGAAA
Right flanking sequence: AGCCGGAAAACAGTCGGCGAAATTTgtcagttttc
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGTCACTGGTAGAAAAGC
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8027 |
nlp-67(sy1176) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGC
Right flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8029 |
R173.3(sy1178) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of R173.3;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTTCGAATTGAGGGTCAACTCTGGAGCAATCCG
Right flanking sequence: taagtacatgattttttattc
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTCTTACCAGTCGCTCTCCA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8031 |
cest-1.1(sy1180) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of cest-1;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CAATTGGAGACCTTCGATATCGAAAACCCCGTCCACCG
Right flanking sequence: AAATCATGGGAAGGAGTTTTGGTAACAAATGAATA
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCTTCCCATGATTTCGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8033 |
F13H6.3(sy1182) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F13H6.3;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GATGGGTACCTCGGGATCCCGTATGCGAAACCACCA
Right flanking sequence: GTCGGCGAACTTCGATTTAAGAAGCCAGTAACCGTTG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AATCGAAGTTCGCCGACTGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8114 |
dod-18(sy1190) I. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-18;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTCATTGAAACAGCTAAAGGAAAATTGACGACTA
Right flanking sequence: TTGTGGAAGAAATGAAAAGAAAAGAGgtatagtta
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGGAAAATTGACGACTATTG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8116 |
C17H12.4(sy1192) IV. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C17H12.4;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CAATTGGAAAATTAAGATTTCAAAAACCAGAACCGCCT
Right flanking sequence: GAGAAATGGACCGGAGTGAGAAATGCAAAAGgtatg
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCGGTCCATTTCTCAGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8118 |
srx-51(sy1194) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-51;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GAACTCATTTGGAATGCTGACTACATCACAGTCTA
Right flanking sequence: TTGGGGATGCAGTTATTTCAACAATTTTTGCATTT
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GACTACATCACAGTCTATTG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8120 |
gnrr-4(sy1196) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-4;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CGGACTGCATCGTTCTCTTTATCTACGCTCCAACT
Right flanking sequence: CAGTTTGCATGGATTCACTCATACTGGgtaagtctg
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAATCCATGCAAACTGAGT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8175 |
Y55B1BR.1(sy1201) III. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC
Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8179 |
pals-14(sy1205) I. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-14;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: TTAAATCCAGTTTAGCAGAGAGAAAAGCGGCAGAG
Right flanking sequence: GAGAGGCACAACAAAGCGgtatgatcatgcttacc
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAGAAAAGCGGCAGAGGAG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8181 |
pals-16(sy1207) III. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTT
Right flanking sequence: Ggtaggttgaagaagttattattggaatttgaaat
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8185 |
H39E23.3(sy1210) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of H39E23.3;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTCGGTCACTGTTCAAGGATTCCCTACAAAAGATC
Right flanking sequence: GTGAGGCCAGAGAGACTGAACCAGTGAAACTGCCAAC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTCCCTACAAAAGATCGTG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8189 |
nlp-76(sy1214) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA
Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8191 |
nlp-77(sy1216) II. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC
Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8201 |
oac-2(sy1218) V. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: aattgtggaatttttagATTTCGAAGAATCCTCCC
Right flanking sequence: GCTGTACTACTTGACCATCTTCCTCATAGTAGTCATG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS8205 |
Y62F5A.10(sy1222) II. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y62F5A.10;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GAAGAAGAAGATAACACGGAAGGAGAAATCCAACA
Right flanking sequence: CCGCACTGAACAAAACAGCATCCAACGACGATCTTC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTTTGTTCAGTGCGGTGT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
