Laboratory Information

NamePX View on WormBase
Allele designationfx
HeadPatrick C. Phillips
InstitutionUniversity of Oregon, Eugene, OR
Address 5289 University of Oregon
Eugene 97403
United States
Website http://www.uoregon.edu/~pphil/
Gene classes disp  thrm 

Strains contributed by this laboratory

Strain Genotype Species Description
PX174 C. elegans wild isolate. C. elegans Isolated at Devil's Lake State Park, Lincoln City, OR. Off a path about 200 feet from a dock in wet, organic topsoil in a forest.
PX176 C. elegans wild isolate. C. elegans Isolated at 2151 Bunker Ridge Road, Eugene, OR. From damp grass compost in a field.
PX178 C. elegans wild isolate. C. elegans Isolated in northwest Hendricks Park, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.
PX179 C. elegans wild isolate. C. elegans Isolated in northwest Hendricks Park, northwest rhododendron garden, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.
PX506 C. remanei wild isolate. C. remanei Male-female strain. Reference strain for the new chromosome-level assembly of the C. remanei genome. This is a natural isolate (BioProject PRJNA577507) inbred to reduce heterozygosity. Reference: https://www.biorxiv.org/content/10.1101/797035v1 (Accepted at Genetics).
PX623 fxDf1 II; him-5(e1490) V. C. elegans fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.
PX627 fxIs1 I; spe-44(fx110[spe-44::degron]) IV. C. elegans fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility. Degron tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.
PX629 fxIs1 I; spe-44(fx110[spe-44::degron]) IV; him-5(e1490) V. C. elegans fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility and reversible male sterility. Him: males produced at ~30%. Degron tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.
PX696 fxIs10 II. C. elegans fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG​) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924
This laboratory hasn't submitted any alleles to the CGC.