Laboratory Information
| Name | OD View on WormBase |
|---|---|
| Allele designation | lt |
| Head | Karen Faye Oegema |
| Institution | Ludwig Institute for Cancer Research |
| Address | 9500 Gilman Drive CMM East, Room 3071 La Jolla 92093 United States |
| Website | http://oegemadesailab.org/ |
| Gene classes | ani cpar czw dgtr hyls kbp mis mvb noca perm rod ska spdl trcs tsg yop zwl cdgs cmt cnep nepr tbca tbcb tbcc tbcd tbce |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| OD1 | unc-119(ed3) III; ltIs1. | C. elegans | ltIs1[pIC22; pie-1 promoter::knl-3::GFP + unc-119(+)]. |
| OD10 | unc-119(ed3) III; ltIs6. | C. elegans | ltIs6 [pIC35; pie-1p::kbp-5::GFP-TEV-STag + unc-119(+)]. |
| OD11 | unc-119(ed3) III; ltIs7. | C. elegans | ltIs7 [(pIC41) pie-1p::kbp-4::GFP::TEV-STag + unc-119(+)]. [NOTE: Array might be prone to silencing; rescue of unc-119 appears incomplete.] |
| OD13 | unc-119(ed3) III; ltIs9. | C. elegans | ltIs9 [pie-1p::kbp-3::GFP::TEV-S Tag + unc-119(+)]. |
| OD139 | unc-119(ed3) III; ltIs37 IV; qaIs3502. | C. elegans | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3502[pie-1::YFP::LMN-1 + unc-119(+)]. |
| OD141 | unc-119(ed3) III; ltIs37 IV; qaIs3546. | C. elegans | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3546 [pie-1p::GFP::npp-8 + unc-119(+)]; npp-8 is CeNup155. |
| OD142 | unc-119(ed3) III; ltIs78. | C. elegans | ltIs78 [(pKO5) pie-1::GFP::TEV::Stag::air-1 spliced coding + unc-119(+)]. |
| OD176 | unc-119(ed3) III; ltIs103. | C. elegans | ltIs103 [(pAA212) pie-1p::GFPLAP::cav-1 + unc-119(+)]. |
| OD177 | unc-119(ed3) III; ltIs104. | C. elegans | ltIs104 [(pAA277) pie-1p::GFP::LAP::vps-37 + unc-119(+)]. |
| OD178 | unc-119(ed3) III; ltIs105. | C. elegans | ltIs105 [(pAA280) pie-1p::GFP::LAP::MVB-12 + unc-119(+)]. |
| OD179 | unc-119(ed3) III; ltIs79; pwIs116. | C. elegans | ltIs79 [(pAA196) pie-1p::mCherry::rab-5 + unc-119(+)]. pwIs116 [rme-2p::rme-2::GFP::rme-2 3'UTR + unc-119(+)]. Maintain at 20-25C to reduce silencing of the array. |
| OD1854 | ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. | C. elegans | ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570. |
| OD2174 | unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). | C. elegans | CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029. |
| OD2359 | fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)] II. | C. elegans | CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300. |
| OD2416 | ltSi249 I; ltSi511 II; nre-1(hd20) lin-15B(hd126) X. | C. elegans | ltSi249 [dlg-1p(delta)7::dlg-1::GFP::unc-54 3'UTR Cbr-unc-119(+)] I. ltSi511 [cnd-1p::mCherry::PH::unc-54 3'UTR Cbr-unc-119(+)] II. During embryogenesis epidermal cell junctions fluoresce green and neuronal cell surface fluoresces red. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570. |
| OD2442 | ltSi794 II; unc-119(ed3) III. | C. elegans | ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398 |
| OD2545 | ltSi814 I; unc-119(ed3) III. | C. elegans | ltSi814 [fzy-1p::GFP::fzy-1::fzy-1 3'UTR + Cbr-unc-119(+)] I. FZY-1::GFP reporter using its own promoter and UTR. Single-copy transgene insertion in Chromosome I using MosSCI. Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300. |
| OD2653 | ltSi1112 I; unc-119(ed3) III. | C. elegans | ltSi1112 [cyb-1p::cyb-1::mNeongreen::cyb-1 3'UTR + Cbr-unc-119(+)] I. CYB-1::mNG reporter using its own promoter and UTR. Single-copy transgene insertion in Chromosome I using MosSCI. Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300. |
| OD27 | unc-119(ed3) III; ltIs14. | C. elegans | ltIs14 [(pASM05) pie-1p::GFP-TEV-STag::air-2 + unc-119(+)]. |
| OD2768 | ltSi910 II; unc-119(ed3) III. | C. elegans | ltSi910 [elt-2p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Intestinal-specific expression of anti-GFP nanobody fused to ZIF-1 mediates intestine-specific degradation of GFP-tagged proteins (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine intestine-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094. |
| OD2769 | ltSi911 II; unc-119(ed3) III. | C. elegans | Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094. |
| OD2770 | ltSi912 II; unc-119(ed3) III. | C. elegans | ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094. |
| OD2771 | ltSi913 II; unc-119(ed3) III. | C. elegans | Control strain for OD2770 |
| OD2772 | ltSi914 II; unc-119(ed3) III. | C. elegans | ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Sensory neuron-specific expression of anti-GFP nanobody fused to ZIF-1 mediates sensory neuron-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094. |
| OD2773 | ltSi915 II; unc-119(ed3) III. | C. elegans | ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. This strain provides a sensory neuron-specific source of ZIF-1 alone and serves as a control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. It can also be used as source of sensory-specific ZIF-1 for other applications. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094. |
| OD2906 | mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. | C. elegans | mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300. |
| OD2909 | san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I. | C. elegans | GFP tag inserted at 5' end of endogenous san-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac |
| OD2984 | ltSi953 II; unc-119(ed3) III. | C. elegans | ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398 |
| OD3 | unc-119(ed3) III; ltIs24. | C. elegans | ltIs24 [(pAZ132) pie-1p::GFP::tba-2 + unc-119(+)]. |
| OD31 | unc-119(ed3) III; ltIs22. | C. elegans | ltIs22[pPM3; pie-1::GFP-TEV-STag::KNL-2 + unc-119(+)]. |
| OD3696 | plk-1(lt106[plk-1 C52V] lt108[plk-1 L115G]) III. | C. elegans | Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481. |
| OD3737 | cyb-3(lt110) V/nT1 [qIs51] (IV;V). | C. elegans | CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029. |
| OD3913 | cyb-1(lt125[cyb-1::LAP::mNG::loxP::3xFlag]) IV. | C. elegans | mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029. |
| OD4027 | ltSi448 II; unc-119(ed3) III; ltIs37 csr-1(tm892) IV. | C. elegans | ltSi448 [csr-1p::GFP::csr-1(re-encoded; GFP inserted after aa #5 of isoform b) + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1764; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409. |
| OD4028 | ltSi240 II; unc-119(ed3) III; csr-1(tm892) IV. | C. elegans | ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1463; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409. |
| OD4087 | cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. | C. elegans | mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029. |
| OD4376 | mdf-1(lt167[mScarlet::tev::loxP::3xFlag::mdf-1])V. | C. elegans | CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372. |
| OD5096 | ify-1(lt212[mNG::ify-1]) II. | C. elegans | mNeonGreen tag inserted at 5' end of endogenous ify-1 locus using CRISPR/Cas9 engineering. gRNA sequence: catactcgcacaagtcaaaA |
| OD5140 | sep-1(lt214[sep-1::GFP]) I. | C. elegans | GFP tag inserted at 3' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tcagattataTTACAAATTT |
| OD5149 | ltSi1668 I; unc-119(ed3) III. | C. elegans | ltSi1668 [cyb-3p::mNeonGreen::cyb-3(re-encoded)::cyb-3 3'UTR + Cbr-unc-119(+)] I. CYB-3::mNG reporter using its own promoter and UTR; cyb-3 was re-encoded to confer resistance to dsRNA targeting endogenous cyb-3. |
| OD56 | unc-119(ed3) III; ltIs37 IV. | C. elegans | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. his-58 genomic sequence is inserted at Spe I site. Robust expression of transgene in early embryos and germ line; some expression in somatic cells also detectable. Maintain under normal conditions. Reference: McNally et al., JCB (2006). |
| OD58 | unc-119(ed3) III; ltIs38. | C. elegans | ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. |
| OD61 | unc-119(ed3) III; ltIs41. | C. elegans | ltIs41[pAA5; pie-1::GFP-TEV-STag::CAR-1; unc-119(+)]. |
| OD62 | unc-119(ed3) III; ltIs42. | C. elegans | ltIs42[pAA19; pie-1::GFP-TEV-Stag::CAR-1deltaN; unc-119(+)]. |
| OD63 | unc-119(ed3) III; ltIs43/+. | C. elegans | ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain. |
| OD7 | unc-119(ed3) III; ltIs3. | C. elegans | ltIs3[pIC31; pie-1 promoter::hcp-1::GFP-TEV-STag + unc-119(+)]. |
| OD73 | unc-119(ed3) III; ltIs38; ltIs24. | C. elegans | ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. ltIs24 [pAZ132; pie-1::GFP::tba-2 + unc-119(+)]. |
| OD76 | unc-119(ed3) III; ltIs75. | C. elegans | ltIs75 [(pSK5) pie-1::GFP::TEV-STag::LacI + unc-119(+)]. |
| OD8 | unc-119(ed3) III; ltIs4. | C. elegans | ltIs4 [(pIC32) pie-1p::mis-12::GFP::TEV-STag + unc-119(+)]. |
| OD83 | unc-119(ed3) III; ltIs37 IV; qaIs3507. | C. elegans | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3507 [pie-1::GFP::lem-2 + unc-119(+)]. |
| OD9 | unc-119(ed3) III; ltIs5. | C. elegans | ltIs5 [(pIC36) pie-1p::kbp-1::GFP::TEV-STag + unc-119(+)]. |
| OD95 | unc-119(ed3) III; ltIs37 IV; ltIs38. | C. elegans | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Essex A, et al. Mol Biol Cell. 2009 Feb;20(4):1252-67. doi: 10.1091/mbc.e08-10-1047. Epub 2008 Dec 24. PMID: 19109417 |
| TH27 | unc-119(ed3) III; ddIs6 V. | C. elegans | ddIs6 [tbg-1::GFP + unc-119(+)] V. |
| TH32 | unc-119(ed3) ruIs32 III; ddIs6 V. | C. elegans | ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. |
This laboratory hasn't submitted any alleles to the CGC.