Laboratory Information
| Name | JCB View on WormBase |
|---|---|
| Allele designation | bet |
| Head | Jill C Bettinger |
| Institution | Virginia Commonwealth University, Richmond, VA |
| Address | Box 980613 410 N. 12th Street Richmond 23298-0613 United States |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| JCB418 | Y67H2A.2(bet63) IV. | C. elegans | Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat. |
| JCB419 | Y76A2B.4(bet65) III. | C. elegans | Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg. |
| JCB426 | chil-11(bet66) IV. | C. elegans | Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta. |
| JCB434 | K04C2.8(bet68) III. | C. elegans | Homozygous viable. Deletion of 796 bp in parental strain N2, with insertion of 13 nucleotides(tcaacaaaatgcc) at break. Left flanking sequence: taatatcctccggaccgata; Right flanking sequence: gtcctgactgataatcatcaac. sgRNA #1: tgtgtagtataaacgattat; sgRNA #2: cgggtcacgagtagagatgg. |
| JCB435 | C14B1.9(bet70) III. | C. elegans | Homozygous viable. Deletion of 973 bp in parental strain N2. Left flanking sequence: aaactacggtaacacccatt; Right flanking sequence: tgacggatgcaatgacaaga. sgRNA #1: gagacctacacatgccaaat; sgRNA #2: tttggattaatgttacctga. |
| JCB455 | K02D10.3(bet75) III. | C. elegans | Homozygous viable. Deletion of 247 bp in parental strain N2.Deletion appears to have occurred at the sgRNA #2 cut site. Left flanking sequence: tttataggaatttcaggaat; Right flanking sequence: ttccgtcaccttccgtcaaa. sgRNA #1: aaatgataagaagccaaagc; sgRNA #2: tttgtgtttatgacgagctc. |
| JCB456 | algn-12(bet74) V/nT1[qls51] (IV;V). | C. elegans | Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa. |
| JCB458 | T19C4.5(bet77) V. | C. elegans | Homozygous viable. Deletion of 1581 bp in parental strain N2. Also contains a SNP (A->T) in right flanking sequence (uppercase text). Left flanking sequence: ctactcatgatataccttct; Right flanking sequence: ccggTgctctcttgttgtct. sgRNA #1: gttttcacatgggcaagaga; sgRNA #2: atttcaattccatttcccac. |
| JCB459 | C18E9.4(bet80) II. | C. elegans | Homozygous viable. Deletion of 492 bp in parental strain N2. Left flanking sequence: agccgtttaagatcccaaac; Right flanking sequence: ggatggtcatcattagaatt. sgRNA #1: ttgctgtagattgagtagtt; sgRNA #2: cacggaaccacctcatggga. |
| JCB461 | Y116F11B.14(bet83) V. | C. elegans | Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga. |
| JCB487 | K02D10.1(bet88) III. | C. elegans | Homozygous viable. Deletion of 2796 bp in parental strain N2. Left flanking sequence: tatgaactttaagaccaact; Right flanking sequence: ggatgggatgcaactgttgc. sgRNA #1: actcatactataagttcagt; sgRNA #2: ctacttgggcaaagccagga. |
| RA7 | rdEx1. | C. elegans | rdEx1 [GFP::tra-1 + rol-6(su1006)]. Rollers. Array can cause sterility. Maintain by picking gravid Rollers. GFP::tra-1 fusion protein. Reference: Mathies LD, et al. Development. 2004 Sep;131(17):4333-43. |
This laboratory hasn't submitted any alleles to the CGC.