Laboratory Information

NameHA View on WormBase
Allele designationrt
HeadAnne Church Hart
InstitutionBrown University
Address 60 Olive Street
SFH 459
Providence 02912
United States
Website http://neuroscience.brown.edu/faculty/profile.php?id=1254250004
Gene classes dos  ess  grk  kcnl  nlp  oca  osm  plst  pqe  sco  tkt  uso  inso  tyms 
gkow  erh 

Strains contributed by this laboratory

Strain Genotype Species Description
HA1019 osm-11(rt142) X. C. elegans Isolated from a deletion library.
HA1706 pha-1(e2123) III; rtEx726. C. elegans rtEx726 [del-1p::YC2.60 + pha-1(+)] expresses yellow cameleon YC2.60 in a subset of motor neurons. Maintain at 25C to select for the presence of the array. Haspel G, et al. (2010) J. Neurosci. 30:11151-6.
HA1722 rtIs29. C. elegans rtIs29 [acr-5p::YC2.60 + pha-1(+)] expresses yellow cameleon YC2.60 in all VB and DB motoneurons and some head and tail neurons. Maintain at 25C to select for the presence of the array. Haspel G, et al. (2010) J. Neurosci. 30:11151-6.
HA1857 osm-7(tm2256) III. C. elegans
HA2031 rtIs31 X. C. elegans rtIs31 [elt-2p::GFP + Posm-10::HtnQ150].
HA2040 sir-2.4(n5137) I; sir-2.1(ok434) IV; sir-2.2(n5136) X. C.elegans Superficially wild-type. Reference: Anderson E, et al.Mech Ageing Dev. 2016 Mar;154:30-42.
HA2464 sod-1(tm776) II; rtSi8 IV; him-5 V; vsIs48. C.elegans rtSi8 [sod-1p::sod-1(A4V) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. vsIs48 [unc-17::GFP]. A4V mutation in C. elegans sod-1 genomic rescue construct mimics human SOD1 disease model. Superficially wild-type with increased sensitivity to paraquat in multiple assays. GFP expressed in all cholinergic neurons. Strain reportedly carries a him-5 mutation in the background, though specific allele has not been confirmed. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA2619 sod-1(tm776) II; rtSi1 IV. C.elegans rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA2823 smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. C.elegans nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
HA2824 smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C41G7.1. Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86.
HA2825 smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. C.elegans rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
HA2845 fust-1(rt255]) II. C.elegans Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2846 fust-1(rt256[R446S]) II. C.elegans fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2847 fust-1(rt257[P447L]) II. C.elegans fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2986 sod-1(rt448[sod-1WT C]) II. C. elegans Superficially wild-type at 25C. Can be maintained 15-25C. rt448 is wild-type control strain for HA3299 containing all the silent codon changes needed for CRISPR/Cas9 genome editing. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA2987 sod-1(rt449[G85RC]) II. C. elegans sod-1(rt449[G85RC]) was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation G93A. This strain also contains additional silent edits, and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2987 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA3 nuIs11. C. elegans nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.
HA300 lin-15B&lin-15A(n765) X; rtEx223. C. elegans rtEx223 [nlp-6p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA307 lin-15B&lin-15A(n765) X; rtEx224. C. elegans rtEx224 [F18E9.2::GFP + lin-15(+)]. Maintain by picking non-Muv. Maintain at 20C.
HA328 lin-15B&lin-15A(n765) X; rtEx233. C. elegans rtEx233 [nlp-11p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA329 lin-15B&lin-15A(n765) X; rtEx234. C. elegans rtEx234 [nlp-13p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv or GFP+ to maintain array.
HA3299 sod-1(rt451[sod-1G85R]) II. C. elegans Superficially wild-type with increased sensitivity to paraquat in multiple assays. Can be maintained 15-25C. rt451 is CRISPR/Cas9 engineered G85R missense mutation in endogenous sod-1 locus mimicking human ALS SOD1 model. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA341 lin-15B&lin-15A(n765) X; rtEx235. C. elegans rtEx235 [nlp-3p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA353 lin-15B&lin-15A(n765) X; rtEx247. C. elegans rtEx247 [nlp-14p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA357 lin-15B&lin-15A(n765) X; rtEx251. C. elegans rtEx251 [nlp-15p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA367 lin-15B&lin-15A(n765) X; rtEx256. C. elegans rtEx256 [nlp-18p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA371 lin-15B&lin-15A(n765) X; rtEx260. C. elegans rtEx260 [nlp-19p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA444 lin-15B&lin-15A(n765) X; rtEx330. C. elegans rtEx330 [nlp-21p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA446 lin-15B&lin-15A(n765) X; rtEx332. C. elegans rtEx332 [nlp-20p::GFP + lin-15(+)]. Pick non-Muv or GFP+ to maintain.
HA449 lin-15B&lin-15A(n765) X; rtEx335. C. elegans rtEx335 [nlp-10p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA450 lin-15B&lin-15A(n765) X; rtEx336. C. elegans rtEx336 [nlp-12p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA659 rtIs11 V. C. elegans rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. HtnQ150 causes ASH degeneration 30% at 8 days.
HA661 rtIs18 I. C. elegans rtIs18 [elt-2p::GFP + osm-10p::HtnQ150].
HA759 pqe-1(rt13) III; rtIs11 V. C. elegans rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.
HA865 grk-2(rt97) III. C. elegans Grossly normal but defective for chemosensory response, including detection of octanol, diacetyl, and isoamyl alcohol.
HA98 lin-15B&lin-15A(n765) X; rtEx66. C. elegans rtEx66 [nlp-2p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
IE53215 ttTi53215 V. C. elegans Homozygous.
KP696 eos-2(nu268) III. C. elegans Weak Osm as homozygote. Non-allelic non-complementor of osm-10(n1602).
KP715 eos-1(nu288) IV. C. elegans Weak Osm as homozygote. Non-allelic non-complementor of osm-10(n1602).
KP987 lin-15B&lin-15A(n765) nuIs1 X. C. elegans nuIs1 [glr-1p::GFP + glr-1(+) + lin-15(+)] X. GFP expression in 17 classes of neurons after 3-fold (see WBPaper00002309). This strain is WT at glr-1.
temp_name209 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. Strain is actually YS2 and allele is cbp-1(bm1).
temp_name210 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. Strain is actually YS4 and allele is cbp-1(bm2).
YS4 cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
rt142 Allele deletion
rt13 Allele substitution nonsense
rt97 Allele substitution