Laboratory Information

NameEG View on WormBase
Allele designationox
HeadErik Mathias Jorgensen
InstitutionUniversity of Utah, Salt Lake City
Address University of Utah
Biology Dept. Jorgensen Lab, Rm. 201
257 South 1400 East
Salt Lake City 84112-0840
United States
Website http://www.biology.utah.edu/jorgensen
Gene classes cpx  ocrl  ofm  pla  trx  gcc  golg  rimb  rund  aipr 

Strains contributed by this laboratory

Strain Genotype Species Description
EG1000 dpy-5(e61) I; rol-6(e187) II; lon-1(e1820) III. C. elegans Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length.
EG1020 bli-6(sc16) IV; dpy-11(e224) V; lon-2(e678) X. C. elegans Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length.
EG1285 lin-15B&lin-15A(n765) oxIs12 X. C. elegans oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons.
EG144 inx-16(ox144) I. C. elegans Pax, Dec-slow (34" defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.
EG1470 oxEx229. C. elegans oxEx229 [Mos1 Substrate + myo-2::GFP]. Should be grown at 25C.
EG1642 lin-15B&lin-15A(n765) X; oxEx166. C. elegans Maintain by picking non-Muv. oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C.
EG1653 oxIs22 II. C. elegans oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral.
EG199 nas-37(ox199) X. C. elegans At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
EG2288 lin-15B&lin-15A(n765) X; oxEx110. C. elegans oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv.
EG2537 oxEx344. C. elegans oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.
EG2710 unc-57(ok310) I. C. elegans T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu
EG276 exp-1(ox276) II. C. elegans Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.
EG2762 oxEx166. C. elegans oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C.
EG3027 unc-26(s1710) IV. C. elegans Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.
EG3283 nas-37(tm410) X. C. elegans At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.
EG4 pbo-5(ox4) V. C. elegans Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.
EG4181 C. briggsae wild isolate. C. briggsae Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16.
EG4207 C. briggsae wild isolate. C. briggsae Mixed "strain" started from many different worms that emerged from the same apricot that gave rise to strain EG4181. Some worms emerged as dauers, but there were also L4s and adults. Consists of a mix of the worms that came from the apricot to try to maintain as much diversity as possible in the population and thus is not a true strain in the traditional sense. It will be sent as contaminated worms since it cannot be cleaned up without going through a bottleneck.
EG4322 ttTi5605 II; unc-119(ed9) III. C. elegans Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]
EG4443 oxIs253 II; unc-119(ed3) III. C. elegans oxIs253 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pCFJ68 inserted by MosSCI into ttTi5605 site.
EG4601 oxIs279 II; unc-119(ed3) III. C. elegans oxIs279 [pie-1p::GFP::H2B + unc-119(+)]. Wild type. Persistent GFP expression in germline. Visible on dissection microscope. Plasmid pCFJ127 inserted by MosSCI into ttTi5605 site.
EG4788 Caenorhabditis sp. 6 wild isolate. C. portoensis Male-female strain. Maintain by mating. Caenorhabditis sp. 6 wild isolate. Isolated by Michael Ailion and Ana-Joao Rodrigues from a rotting apple collected from the home of Anabela Fernandes in Amares, Portugal (address: Dr. Adolofo Vilela, no. 29, 4720-019 Amares, Portugal). Coordinates: 41 degrees, 37', 43.577 " N; 8 degrees, 20', 51.421 " W. Apple collected March 28, 2007. The apple produced a number of growing animals in different stages, including adults of both sexes. Male/Female Caenorhabditis species. 18S RNA sequence places it closest to PS1010 C. sp. 3.
EG4813 lin-15B&lin-15A(n765) X; oxEx1088. C. elegans oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type.
EG4814 lin-15B&lin-15A(n765) X; oxEx1089. C. elegans oxEx1089 [unc-47p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type.
EG4883 oxIs318 II; unc-119(ed3) III. C. elegans oxIs318 [spe-11p::mCherry::histone + unc-119(+)]. Wild type. Dim mCherry expression in hermaphrodite sperm. Barely visible on bright dissection microscope; visible on compound microscope. Plasmid pCFJ167 inserted by MosSCI into ttTi5605 site.
EG4887 oxIs322 II; unc-119(ed3) III. C. elegans oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.
EG5003 unc-119(ed3) III; cxTi10882 IV. C. elegans Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).
EG5025 oxIs351 X. C. elegans oxIs351 contains [unc-47p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
EG5027 oxIs353 V. C. elegans oxIs353 contains [myo-3p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
EG5071 unc-119(ed3) III; oxIs363 IV. C. elegans oxIs363 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pBN04 inserted by MosSCI into cxTi10882 site.
EG5096 oxIs364 X. C. elegans oxIs364 contains [unc-17p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
EG5568 dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. C. elegans dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Dpy, mCherry pharyngeal muscle, dim GFP+ in coelomycytes. Insertion/deletion into cxTi10882 MosSCI site on Chr. IV. Can be used as balancer.
EG6032 ttTi4348 I; unc-18(md299) X. C. elegans Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS).
EG6053 oxSi212 II; unc-119(ed3) III. C. elegans oxSi212 [pie-1p::GFP::mCherry::H2B::gld-2 3'UTR::operonGFP::H2B::cye-1UTR] II. Maintain under normal conditions; expression is stable. Superficially wildtype. Bright, nuclear mCherry and GFP fluorescence in germline. Reference: Frokjaer-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.
EG6070 oxSi221 II; unc-119(ed3) III. C. elegans oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer.
EG6109 unc-119(ed3) III; oxSi230 X. C. elegans oxSi230 [eft-3p::GFP + Cbr-unc-119(+)] X. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi14024 on Chr. X. Can be used as balancer.
EG6171 oxSi257 I; unc-119(ed3) III. C. elegans oxSi257 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4391 on Chr. I. Can be used as balancer.
EG6173 oxSi259 I; unc-119(ed3) III. C. elegans oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4348 on Chr. I. Can be used as balancer.
EG6250 unc-119(ed3) III; cxTi10882 IV. C. elegans Unc. Not caused by cxTi10882. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). Grows best on HB101 bacteria. Reference: Frokjaer-Jensen C, et al., Nat Genet. 2008 Nov;40(11):1375-83.
EG6401 unc-119(ed3) III; oxSi346 IV. C. elegans oxSi346 [eft-3p::GFP + Cbr-unc-119(+)] IV. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site cxTi10816 on Chr. IV. Can be used as balancer.
EG6629 oxIs565 II; oxTi80 III; oxSi199 IV. C. elegans oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.
EG6699 ttTi5605 II; unc-119(ed3) III; oxEx1578. C. elegans oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.]
EG6700 unc-119(ed3) III; cxTi10882 IV; oxEx1579. C. elegans oxEx1579 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6701 ttTi4348 I; unc-119(ed3) III; oxEx1580. C. elegans oxEx1580 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6702 ttTi4391 I; unc-119(ed3) III; oxEx1581. C. elegans oxEx1581 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6703 unc-119(ed3) III; cxTi10816 IV; oxEx1582. C. elegans oxEx1582 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. oxEx1582 array is stable; pick individual animals to obtain Uncs rather than maintaining by chunking.
EG6704 unc-119(ed3) III; ttTi44501 X; oxEx1583. C. elegans oxEx1583 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6705 unc-119(ed3) III; ttTi14024 X; oxEx1584. C. elegans oxEx1584 [eft-3p::GFP + Cbr-unc-119]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6787 oxSi487 II; unc-119(ed3) III. C. elegans oxSi487 [mex-5p::mCherry::H2B::tbb-2 3'UTR::gpd-2 operon::GFP::H2B::cye-1 3'UTR + unc-119(+)] II. MosSCI insertion into ttTi5605 site on Chr II. unc-119 rescue, bright nuclear GFP and nuclear mCherry fluorescence in germline.
EG7212 oxTi330 III; gaIs283. C. elegans oxTi330 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7213 oxTi331 I; gaIs283. C. elegans oxTi331 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7214 oxTi333 X; gaIs283. C. elegans oxTi333 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7215 oxTi334; gaIs283. C. elegans oxTi334 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7216 oxTi335 X; gaIs283. C. elegans oxTi335 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7309 unc-119(ed3) III; oxTi417 V. C. elegans oxTi417 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7477 syIs46 II; unc-119(ed3) III; oxTi483 X. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi483 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7478 syIs46 II; unc-119(ed3) III; oxTi487 X. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi487 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7522 syIs46 II; oxTi467 unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi467 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
EG7523 oxTi468 I; syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi468 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
EG7524 syIs46 II; unc-119(ed3) III; oxTi469 IV. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi469 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
EG7525 oxTi470 syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi470 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7526 oxTi471 syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi471 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7527 oxTi472 syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi472 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7528 oxTi473 syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi473 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7529 syIs46 II; unc-119(ed3) III; oxTi474 V. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi474 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490) V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7530 syIs46 II; unc-119(ed3) III; oxTi475 V. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi475 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7531 syIs46 II; unc-119(ed3) III; oxTi476 V. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi476 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7532 syIs46 II; unc-119(ed3) III; oxTi477 IV. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi477 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7533 syIs46 II; unc-119(ed3) III; oxTi478 V. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi478 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7534 oxTi480 syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi480 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7535 oxTi481 I; syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi481 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7536 syIs46 II; unc-119(ed3) III; oxTi482 IV. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi482 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7538 syIs46 II; unc-119(ed3) oxTi485 III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi485 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7539 syIs46 II; unc-119(ed3) III; oxTi486 V. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi486 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7541 oxTi479 I; syIs46 II; unc-119(ed3) III. C. elegans syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi479 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7565 unc-119(ed3) III; oxTi392 V. C. elegans oxTi392 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7566 unc-119(ed3) III; oxTi211 V. C. elegans oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
EG7826 unc-119(ed3) III; oxTi308 X. C. elegans oxTi308 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7828 oxTi310 II; unc-119(ed3) III. C. elegans oxTi310 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7831 oxTi648 I; unc-119(ed3) III. C. elegans oxTi648 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7832 oxTi638 I; unc-119(ed3) III. C. elegans oxTi638 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7833 oxTi559 I; unc-119(ed3) III. C. elegans oxTi559 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:-4.48. Please see www.wormbuilder.org for exact insertion site.
EG7835 oxTi556 I; unc-119(ed3) III. C. elegans oxTi556 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.23. Please see www.wormbuilder.org for exact insertion site.
EG7836 oxTi587 I; unc-119(ed3) III. C. elegans oxTi587 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.28. Please see www.wormbuilder.org for exact insertion site.
EG7837 oxTi712 I; unc-119(ed3) III. C. elegans oxTi712 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.29. Please see www.wormbuilder.org for exact insertion site.
EG7838 oxTi718 I; unc-119(ed3) III. C. elegans oxTi718 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.07. Please see www.wormbuilder.org for exact insertion site.
EG7839 oxTi623 I; unc-119(ed3) III. C. elegans oxTi623 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.75. Please see www.wormbuilder.org for exact insertion site.
EG7840 oxTi590 I; unc-119(ed3) III. C. elegans oxTi590 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:3.35. Please see www.wormbuilder.org for exact insertion site.
EG7841 oxTi302 I; unc-119(ed3) III. C. elegans oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7842 oxTi653 I; unc-119(ed3) III. C. elegans oxTi653 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7843 oxTi398 I; unc-119(ed3) III. C. elegans oxTi398 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:14.26. Please see www.wormbuilder.org for exact insertion site.
EG7844 oxTi413 I; unc-119(ed3) III. C. elegans oxTi413 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:17.17. Please see www.wormbuilder.org for exact insertion site.
EG7845 oxTi571 I; unc-119(ed3) III. C. elegans oxTi571 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:21.62. Please see www.wormbuilder.org for exact insertion site.
EG7846 oxTi700 I; unc-119(ed3) III. C. elegans oxTi700 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:22.30. Please see www.wormbuilder.org for exact insertion site.
EG7847 oxTi723 I; unc-119(ed3) III. C. elegans oxTi723 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:25.79. Please see www.wormbuilder.org for exact insertion site.
EG7848 oxTi626 I; unc-119(ed3) III. C. elegans oxTi626 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:29.18. Please see www.wormbuilder.org for exact insertion site.
EG7851 oxTi732 I; unc-119(ed3) III. C. elegans oxTi732 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:29.97. Please see www.wormbuilder.org for exact insertion site.
EG7854 oxTi730 I; unc-119(ed3) III. C. elegans oxTi730 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7855 oxTi724 II; unc-119(ed3) III. C. elegans oxTi724 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7856 oxTi624 II; unc-119(ed3) III. C. elegans oxTi624 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7857 oxTi628 II; unc-119(ed3) III. C. elegans oxTi628 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7858 oxTi729 II; unc-119(ed3) III. C. elegans oxTi729 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7859 oxTi402 II; unc-119(ed3) III. C. elegans oxTi402 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7860 oxTi677 II; unc-119(ed3) III. C. elegans oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-12.17. Please see www.wormbuilder.org for exact insertion site.
EG7862 oxTi647 II; unc-119(ed3) III. C. elegans oxTi647 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7863 oxTi717 II; unc-119(ed3) III. C. elegans oxTi717 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-4.73. Please see www.wormbuilder.org for exact insertion site.
EG7864 oxTi726 II; unc-119(ed3) III. C. elegans oxTi726 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-1.02. Please see www.wormbuilder.org for exact insertion site.
EG7865 oxTi617 II; unc-119(ed3) III. C. elegans oxTi617 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7866 oxTi564 II; unc-119(ed3) III. C. elegans oxTi564 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7867 oxTi394 II; unc-119(ed3) III. C. elegans oxTi394 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7868 oxTi629 II; unc-119(ed3) III. C. elegans oxTi629 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7869 oxTi582 II; unc-119(ed3) III. C. elegans oxTi582 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7870 oxTi540 II; unc-119(ed3) III. C. elegans oxTi540 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7871 oxTi548 II; unc-119(ed3) III. C. elegans oxTi548 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7872 oxTi573 II; unc-119(ed3) III. C. elegans oxTi573 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7873 oxTi609 II; unc-119(ed3) III. C. elegans oxTi609 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7874 oxTi714 II; unc-119(ed3) III. C. elegans oxTi714 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7875 oxTi574 II; unc-119(ed3) III. C. elegans oxTi574 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7876 oxTi722 II; unc-119(ed3) III. C. elegans oxTi722 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7877 oxTi583 II; unc-119(ed3) III. C. elegans oxTi583 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7878 oxTi720 II; unc-119(ed3) III. C. elegans oxTi720 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7879 oxTi296 II; unc-119(ed3) III. C. elegans oxTi296 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7880 oxTi589 II; unc-119(ed3) III. C. elegans oxTi589 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7881 oxTi409 II; unc-119(ed3) III; him-5(e1490) V. C. elegans oxTi409 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site.
EG7882 oxTi657 II; unc-119(ed3) III. C. elegans oxTi657 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7884 oxTi607 II; unc-119(ed3) III. C. elegans oxTi607 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7885 oxTi721 II; unc-119(ed3) III. C. elegans oxTi721 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7886 oxTi399 II; unc-119(ed3) III. C. elegans oxTi399 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7887 oxTi731 unc-119(ed3) III. C. elegans oxTi731 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7888 oxTi641 unc-119(ed3) III. C. elegans oxTi641 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7890 oxTi706 unc-119(ed3) III. C. elegans oxTi706 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7891 oxTi544 unc-119(ed3) III. C. elegans oxTi544 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7892 oxTi612 unc-119(ed3) III. C. elegans oxTi612 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7893 oxTi615 unc-119(ed3) III. C. elegans oxTi615 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7894 oxTi603 unc-119(ed3) III. C. elegans oxTi603 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7895 oxTi411 unc-119(ed3) III. C. elegans oxTi411 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7896 oxTi627 unc-119(ed3) III. C. elegans oxTi627 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7897 oxTi719 unc-119(ed3) III. C. elegans oxTi719 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7898 oxTi619 unc-119(ed3) III. C. elegans oxTi619 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7899 unc-119(ed3) oxTi734 III. C. elegans oxTi734 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7900 unc-119(ed3) oxTi546 III. C. elegans oxTi546 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7901 unc-119(ed3) oxTi539 III. C. elegans oxTi539 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7902 unc-119(ed3) oxTi713 III. C. elegans oxTi713 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7903 unc-119(ed3) oxTi715 III. C. elegans oxTi715 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7904 unc-119(ed3) III; oxTi716 IV. C. elegans oxTi716 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7905 unc-119(ed3) III; oxTi390 IV. C. elegans oxTi390 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7906 unc-119(ed3) III; oxTi608 IV. C. elegans oxTi608 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7907 unc-119(ed3) III; oxTi408 IV; him-5(e1490) V. C. elegans oxTi408 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site.
EG7908 unc-119(ed3) III; oxTi636 IV. C. elegans oxTi636 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7909 unc-119(ed3) III; oxTi670 IV. C. elegans oxTi670 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7910 unc-119(ed3) III; oxTi420 IV. C. elegans oxTi420 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7911 unc-119(ed3) III; oxTi705 IV. C. elegans oxTi705 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7912 unc-119(ed3) III; oxTi397 IV. C. elegans oxTi397 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7913 unc-119(ed3) III; oxTi563 IV. C. elegans oxTi563 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7914 unc-119(ed3) III; oxTi622 IV. C. elegans oxTi622 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7915 unc-119(ed3) III; oxTi419 IV. C. elegans oxTi419 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7916 unc-119(ed3) III; oxTi208 IV. C. elegans oxTi208 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
EG7917 unc-119(ed3) III; oxTi616 IV. C. elegans oxTi616 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7918 unc-119(ed3) III; oxTi727 IV. C. elegans oxTi727 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7919 unc-119(ed3) III; oxTi584 IV. C. elegans oxTi584 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7920 unc-119(ed3) III; oxTi551 IV. C. elegans oxTi551 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. [NOTE (8-17-2016) One researcher has noticed an unusual segregation pattern of the oxTi551 insertion. This strain may contain more than one insertion or is possible mis-mapped - the authors recommend that you verify the location of this insertion prior to using it as a genetic marker.] Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7921 unc-119(ed3) III; oxTi414 IV. C. elegans oxTi414 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7922 unc-119(ed3) III; oxTi537 IV. C. elegans oxTi537 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7923 unc-119(ed3) III; oxTi552 IV. C. elegans oxTi552 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7924 unc-119(ed3) III; oxTi599 IV. C. elegans oxTi599 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7925 unc-119(ed3) III; oxTi611 IV. C. elegans oxTi611 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7926 unc-119(ed3) III; oxTi418 IV. C. elegans oxTi418 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7927 unc-119(ed3) III; oxTi404 IV. C. elegans oxTi404 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7928 unc-119(ed3) III; oxTi407 IV; him-5(e1490) V. C. elegans oxTi407 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site.
EG7929 unc-119(ed3) III; oxTi602 IV. C. elegans oxTi602 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7930 unc-119(ed3) III; oxTi538 IV. C. elegans oxTi538 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7931 unc-119(ed3) III; oxTi577 IV. C. elegans oxTi577 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7932 unc-119(ed3) III; oxTi592 IV. C. elegans oxTi592 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7933 unc-119(ed3) III; oxTi391 IV. C. elegans oxTi391 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7934 unc-119(ed3) III; oxTi554 IV. C. elegans oxTi554 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7935 unc-119(ed3) III; oxTi581 IV. C. elegans oxTi581 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7936 unc-119(ed3) III; oxTi664 V. C. elegans oxTi664 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7938 unc-119(ed3) III; oxTi640 V. C. elegans oxTi640 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7939 unc-119(ed3) III; oxTi654 V. C. elegans oxTi654 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7940 unc-119(ed3) III; oxTi708 V. C. elegans oxTi708 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7941 unc-119(ed3) III; oxTi396 V. C. elegans oxTi396 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7942 unc-119(ed3) III; oxTi393 V. C. elegans oxTi393 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7943 unc-119(ed3) III; oxTi703 V. C. elegans oxTi703 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7944 unc-119(ed3) III; oxTi553 V. C. elegans oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7945 unc-119(ed3) III; oxTi543 V. C. elegans oxTi543 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7946 unc-119(ed3) III; oxTi580 V. C. elegans oxTi580 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7947 unc-119(ed3) III; oxTi606 V. C. elegans oxTi606 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7948 unc-119(ed3) III; oxTi620 V. C. elegans oxTi620 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7949 unc-119(ed3) III; oxTi635 V. C. elegans oxTi635 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7950 unc-119(ed3) III; oxTi711 V. C. elegans oxTi711 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7951 unc-119(ed3) III; oxTi630 V. C. elegans oxTi630 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7952 unc-119(ed3) III; oxTi207 V. C. elegans oxTi207 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
EG7953 unc-119(ed3) III; oxTi542 V. C. elegans oxTi542 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7954 unc-119(ed3) III; oxTi575 V. C. elegans oxTi575 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7955 unc-119(ed3) III; oxTi725 V. C. elegans oxTi725 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7956 unc-119(ed3) III; oxTi547 V. C. elegans oxTi547 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7957 unc-119(ed3) III; oxTi389 V. C. elegans oxTi389 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7958 unc-119(ed3) III; oxTi710 V. C. elegans oxTi710 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7959 unc-119(ed3) III; him-5(e1490) oxTi405 V. C. elegans oxTi405 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] V. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background at Chr. V:8.97. Please see www.wormbuilder.org for exact insertion site.
EG7960 unc-119(ed3) III; oxTi401 V. C. elegans oxTi401 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7968 unc-119(ed3) III; oxTi633 V. C. elegans oxTi633 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7969 unc-119(ed3) III; oxTi621 X. C. elegans oxTi621 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7970 unc-119(ed3) III; oxTi597 X. C. elegans oxTi597 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7971 unc-119(ed3) III; him-5(e1490) V; oxTi406 X. C. elegans oxTi406 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site.
EG7972 unc-119(ed3) III; oxTi673 X. C. elegans oxTi673 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7975 unc-119(ed3) III; oxTi651 X. C. elegans oxTi651 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7976 unc-119(ed3) III; oxTi702 X. C. elegans oxTi702 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7977 unc-119(ed3) III; oxTi410 X. C. elegans oxTi410 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7978 unc-119(ed3) III; oxTi675 X. C. elegans oxTi675 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7980 unc-119(ed3) III; oxTi557 X. C. elegans oxTi557 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7981 unc-119(ed3) III; oxTi639 X. C. elegans oxTi639 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7982 unc-119(ed3) III; oxTi728 X. C. elegans oxTi728 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7983 unc-119(ed3) III; oxTi595 X. C. elegans oxTi595 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7984 unc-119(ed3) III; oxTi637 X. C. elegans oxTi637 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7985 unc-119(ed3) III; oxTi566 X. C. elegans oxTi566 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7986 unc-119(ed3) III; oxTi421 X. C. elegans oxTi421 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7987 unc-119(ed3) III; oxTi416 X. C. elegans oxTi416 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7988 unc-119(ed3) III; oxTi704 X. C. elegans oxTi704 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7989 unc-119(ed3) III; oxTi668 X. C. elegans oxTi668 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7990 unc-119(ed3) III; oxTi400 X. C. elegans oxTi400 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7991 unc-119(ed3) III; oxTi594 X. C. elegans oxTi594 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7992 unc-119(ed3) III; oxTi545 X. C. elegans oxTi545 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7993 unc-119(ed3) III; oxTi412 X. C. elegans oxTi412 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7994 unc-119(ed3) III; oxTi395 X. C. elegans oxTi395 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7995 unc-119(ed3) III; oxTi596 X. C. elegans oxTi596 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7996 unc-119(ed3) III; oxTi403 X. C. elegans oxTi403 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7998 unc-119(ed3) III; oxTi709 X. C. elegans oxTi709 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7999 unc-119(ed3) III; oxTi649 X. C. elegans oxTi649 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG8000 unc-119(ed3) III; oxTi659 X. C. elegans oxTi659 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG8001 unc-119(ed3) III; oxTi701 X. C. elegans oxTi701 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG8003 unc-119(ed3) III; oxTi707 X. C. elegans oxTi707 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG8004 oxTi550 I; unc-119(ed3) III. C. elegans oxTi550 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:-18.63. Please see www.wormbuilder.org for exact insertion site.
EG8040 oxTi302 I; oxTi75 II; oxTi411 unc-119(ed3) III; him-8(e1489) IV. C. elegans oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]; inserted in Chr. I: 10,166,145. oxTi75 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] II; inserted in Chr. II: 5,448,544. oxTi411 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] inserted in Chr. III: 6,076,837. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information.
EG8041 oxTi76 IV; oxTi405 him-5(e1490) V; oxTi421 X. C. elegans oxTi76 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)]; inserted in Chr. IV: 11,899,008. oxTi405 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]; inserted in Chr. V: 15,838,568. oxTi421 [eft-3p::mCherry::tbb-2 3'UTR] inserted in Chr. X: 6,180,397. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information.
EG8072 oxSi259 I; oxIs322 II; oxTi81 V. C. elegans oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Cytoplasmic, green fluorescence expressed broadly (most cells). Integration into ttTi4348 mosSCI site (I:-5.32). oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Combined fluorescent balancer strain for LG I, LG II and LG V.
EG8073 oxIs322 II; oxSi199 IV; oxTi81 him-5(e1490) V. C. elegans oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG II, LG IV and LG V. Strain contains him-5(e1490) to generate males for crosses.
EG8078 oxTi185 I; unc-119(ed3) III. C. elegans oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8079 oxTi179 II; unc-119(ed3) III. C. elegans oxTi179 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8080 oxTi444 unc-119(ed3) III. C. elegans oxTi444 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8081 unc-119(ed3) III; oxTi177 IV. C. elegans oxTi177 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8082 unc-119(ed3) III; oxTi365 V. C. elegans oxTi365 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8083 unc-119(ed3) III; oxTi354 V. C. elegans oxTi354 [myo-2p::GFP::H2B + ttTi5605 + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals contain a myo-2p::GFP::H2B construct next to the insertion site and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.
EG8397 oxIs322 II; oxTi80 III; him-5(e1490) V. C. elegans oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses.
EG8398 oxIs322 II; oxTi80 III; oxSi199 IV; him-5(e1490) V. C. elegans oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG II, LG III and LG IV. Strain contains him-5(e1490) to generate males for crosses.
EG8760 oxIs322 II; oxTi79 III; him-5(e1490) V. C. elegans oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi79 [eft-3p::GFP::H2B::tbb-2 3' UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: -26.22. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses.
EG8776 oxSi255 I; oxIs322 II; oxSi199 IV; him-5(e1490) V. C. elegans oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG I, LG II and LG IV. Strain contains him-5(e1490) to generate males for crosses.
EG8829 unc-119(ed3) oxTi872 III. C. elegans oxTi872 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-1.41). Insertion into C23G10.7 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8830 unc-119(ed3) III; oxTi873 IV. C. elegans oxTi873 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.44). Insertion into ZK896.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8831 unc-119(ed3) III; oxTi874 V. C. elegans oxTi874 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-13.00). Insertion into srh-36. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8832 unc-119(ed3) III; oxTi875 V. C. elegans oxTi875 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: High percentage of males observed (unpublished observations, Chee Kiang Ewe, Rothman lab, UCSB). NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.19). Insertion into pro-3 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8833 unc-119(ed3) III; oxTi876 IV. C. elegans oxTi876 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.53). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8834 oxTi877 II; unc-119(ed3) III C. elegans oxTi877 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-2.02). Insertion into ggr-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8835 unc-119(ed3) III; oxTi878 V. C. elegans oxTi878 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.58). Insertion into B0507.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8836 unc-119(ed3) III; oxTi879 V. C. elegans oxTi879 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.02). Insertion into H24G06.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8837 unc-119(ed3) III; oxTi880 IV. C. elegans oxTi880 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:1.82). Insertion into drp-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8838 oxTi882 II; unc-119(ed3) III. C. elegans oxTi882 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.13). Insertion into ncRNA C44B7.21. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8839 unc-119(ed3) III; oxTi884 IV. C. elegans oxTi884 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.90). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8840 unc-119(ed3) III; oxTi885 X. C. elegans oxTi885 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:9.13). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8841 oxTi886 II; unc-119(ed3) III. C. elegans oxTi886 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-14.32). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8842 oxTi887 II; unc-119(ed3) III. C. elegans oxTi887 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:2.59). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8843 unc-119(ed3) III; oxTi888 V. C. elegans oxTi888 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:3.88). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8844 unc-119(ed3) III; oxTi889 V. C. elegans oxTi889 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.44). Insertion into F25G6.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8845 unc-119(ed3) III; oxTi890 X. C. elegans oxTi890 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-0.43). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8846 oxTi891 II; unc-119(ed3) III. C. elegans oxTi891 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-0.61). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8847 oxTi892 unc-119(ed3) III. C. elegans oxTi892 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.93). Insertion into srv-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8848 unc-119(ed3) III; oxTi893 X. C. elegans oxTi893 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:0.57). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8849 unc-119(ed3) III; oxTi894 V. C. elegans oxTi894 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.54). Insertion into srh-131. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8850 oxTi895 I; unc-119(ed3) III. C. elegans oxTi895 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:0.22). Insertion into klp-15. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8851 oxTi897 unc-119(ed3) III. C. elegans oxTi897 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.36). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8852 unc-119(ed3) III; oxTi898 X. C. elegans oxTi898 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.44). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8853 unc-119(ed3) III; oxTi899 X. C. elegans oxTi899 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.63). Insertion into cTel55X. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8854 unc-119(ed3) III; oxTi900 X. C. elegans oxTi900 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-9.39). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8855 unc-119(ed3) III; oxTi901 V. C. elegans oxTi901 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:19.80). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8856 oxTi902 I; unc-119(ed3) III. C. elegans oxTi902 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-1.50). Insertion into anc-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8857 oxTi903 II; unc-119(ed3) III. C. elegans oxTi903 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.15). Insertion into nlp-18. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8858 oxTi904 II; unc-119(ed3) III. C. elegans oxTi904 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.50). Insertion into dyf-13. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8859 unc-119(ed3) III; oxTi905 X. C. elegans oxTi905 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.08). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8860 unc-119(ed3) III; oxTi906 V. C. elegans oxTi906 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:24.52). Insertion into ttx-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8861 unc-119(ed3) III; oxTi907 V. C. elegans oxTi907 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.98). Insertion into srz-92 (pseudogene). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8862 unc-119(ed3) III; oxTi908 V. C. elegans oxTi908 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:12.85). Insertion into sri-70. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8863 unc-119(ed3) III; oxTi909 IV. C. elegans oxTi909 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.02). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8864 unc-119(ed3) III; oxTi910 X. C. elegans oxTi910 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.62). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8865 unc-119(ed3) III; oxTi911 V. C. elegans oxTi911 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:4.95). Insertion into dhc-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8866 unc-119(ed3) III; oxTi912. C. elegans oxTi912 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:14.22). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8867 unc-119(ed3) III; oxTi914 IV. C. elegans oxTi914 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:-25.76). Insertion into F56A11.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8868 unc-119(ed3) III; oxTi915 IV. C. elegans oxTi915 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:-5.63). Insertion into puf-4 (pseudogene). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8869 oxTi917 I; unc-119(ed3) III. C. elegans oxTi917 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:8.72). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8870 oxTi918 I; unc-119(ed3) III. C. elegans oxTi918 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:1.67). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8871 oxTi919 I; unc-119(ed3) III. C. elegans oxTi919 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:13.92). Insertion into sra-25. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8872 oxTi920 I; unc-119(ed3) III. C. elegans oxTi920 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:1.60). Insertion into C30F12.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8873 unc-119(ed3) III; oxTi921 IV. C. elegans oxTi921 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:8.85). Insertion into rab-19. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8874 unc-119(ed3) III; oxTi922 V. C. elegans oxTi922 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:8.58). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8875 oxTi923 I; unc-119(ed3) III. C. elegans oxTi923 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:3.44). Insertion into hgo-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8876 oxTi924 II; unc-119(ed3) III. C. elegans oxTi924 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:22.90). Insertion into srh-42. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8877 oxTi925 I; unc-119(ed3) III. C. elegans oxTi925 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:7.93). Insertion into F36D1.8 (promoter). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8878 oxTi926 I; unc-119(ed3) III. C. elegans oxTi926 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:24.67). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8879 unc-119(ed3) III; oxTi927 IV. C. elegans oxTi927 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:-16.25). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8880 oxTi928 I; unc-119(ed3) III. C. elegans oxTi928 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-7.69). Insertion into F32B5.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8881 oxTi929 II; unc-119(ed3) III. C. elegans oxTi929 [eft-3p::GFP::2xNLS::tbb-2 3'UTR +Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.16). Insertion into F33A8.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8882 oxTi930 II; unc-119(ed3) III. C. elegans oxTi930 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.05). Insertion into F15A4.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8883 oxTi931 II; unc-119(ed3) III. C. elegans oxTi931 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.49). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8884 unc-119(ed3) III; oxTi932 X. C. elegans oxTi932 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.09). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8885 unc-119(ed3) III; oxTi933 V. C. elegans oxTi933 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:3.38). Insertion into D2023.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8886 oxTi934 I; unc-119(ed3) III. C. elegans oxTi934 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-3.79). Insertion into W05F2.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8887 oxTi935 unc-119(ed3) III. C. elegans oxTi935 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.17). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8888 unc-119(ed3) III; oxTi936 X. C. elegans oxTi936 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-13.81). Insertion into igcm-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8889 unc-119(ed3) III; oxTi938 IV. C. elegans oxTi938 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:2.79). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8890 oxTi939 II; unc-119(ed3) III. C. elegans oxTi939 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.12). Intergenic insertion into snt-1 3' UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8891 oxTi940 II; unc-119(ed3) III. C. elegans oxTi940 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.56). Insertion into C06A8.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8892 oxTi941 II; unc-119(ed3) III. C. elegans oxTi941 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-2.60). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8893 oxTi943 II; unc-119(ed3) III. C. elegans oxTi943 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:20.30). Insertion into histone cluster (non-unique read). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8894 oxTi944 II; unc-119(ed3) III. C. elegans oxTi944 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-17.95). Insertion into C23H3.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8895 oxTi945 unc-119(ed3) III. C. elegans oxTi945 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-15.41). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8896 oxTi946 I; unc-119(ed3) III. C. elegans oxTi946 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:2.69). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8897 unc-119(ed3) III; oxTi947 V. C. elegans oxTi947 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-20.00). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8898 unc-119(ed3) III; oxTi949 IV. C. elegans oxTi949 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.22). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8899 oxTi951 I; unc-119(ed3) III. C. elegans oxTi951 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-0.73). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8900 unc-119(ed3) III; oxTi953 X. C. elegans oxTi953 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-2.45). Insertion into abts-4. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8901 unc-119(ed3) III; oxTi954 X. C. elegans oxTi954 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-7.13). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8902 oxTi956 unc-119(ed3) III. C. elegans oxTi956 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:0.03). Insertion into trxr-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8903 oxTi957 II; unc-119(ed3) III. C. elegans oxTi957 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.08). Insertion into mnk-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8904 oxTi959 I; unc-119(ed3) III. C. elegans oxTi959 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:3.91). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8905 unc-119(ed3) III; oxTi961 V. C. elegans oxTi961 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:13.04). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8906 oxTi962 unc-119(ed3) III. C. elegans oxTi962 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.35). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8907 unc-119(ed3) III; oxTi963 V. C. elegans oxTi963 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:12.90). Insertion into srbc-27. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8908 unc-119(ed3) III; oxTi965 V. C. elegans oxTi965 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-2.52). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8909 unc-119(ed3) III; oxTi966 V. C. elegans oxTi966 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:18.45). Insertion into emb-4. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8910 oxTi967 I; unc-119(ed3) III. C. elegans oxTi967 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-1.28). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8911 unc-119(ed3) III; oxTi968 X. C. elegans oxTi968 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-3.89). Insertion into C09B8.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8912 oxTi969 II; unc-119(ed3) III. C. elegans oxTi969 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:18.17). Insertion into lin-38. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8913 unc-119(ed3) III; oxTi970 IV. C. elegans oxTi970 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.92). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8914 unc-119(ed3) III; oxTi971 IV. C. elegans oxTi971 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:11.69). Insertion into Y64G10A.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8915 oxTi973 V. C. elegans oxTi973 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-19.85). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8916 oxTi974 II. C. elegans oxTi974 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-11.63). Insertion into fbxb-105. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8917 oxTi975 III. C. elegans oxTi975 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.94). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8918 oxTi976 II. C. elegans oxTi976 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.84). Insertion into D2085.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8919 oxTi977 I. C. elegans oxTi977 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:2.42). Insertion into T22C1.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8920 oxTi979 I. C. elegans oxTi979 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:5.06). Insertion into B0205.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8921 oxTi980 V. C. elegans oxTi980 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-18.05). Insertion into srbc-41 promoter. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8922 oxTi981 I. C. elegans oxTi981 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:24.77). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8923 oxTi983 I. C. elegans oxTi983 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-14.58). Insertion into src-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8924 oxTi984 II. C. elegans oxTi984 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.12). Insertion into srh-72. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8925 oxTi986 X. C. elegans oxTi986 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-20.67). Insertion into T08D2.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8926 oxTi987 V. C. elegans oxTi987 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.20). Insertion into dyf-17. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8927 oxTi988 IV. C. elegans oxTi988 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.23). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8928 oxTi989 III. C. elegans oxTi989 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:19.10). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8929 oxTi990 II. C. elegans oxTi990 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.87). Insertion into trcs-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8930 oxTi991 V. C. elegans oxTi991 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:5.59). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8931 oxTi992 II. C. elegans oxTi992 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.96). Insertion into K10B4.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
EG8932 oxTi993 I. C. elegans oxTi993 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:25.92). Insertion into Y105E8B.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8933 oxTi994 IV. C. elegans oxTi994 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:2.45). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8934 oxTi995 I. C. elegans oxTi995 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-0.03). Insertion into pqn-44. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8935 oxTi996 IV. C. elegans oxTi996 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.87). Insertion into mbk-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8936 oxTi997 V. C. elegans oxTi997 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.06). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8937 oxTi998 V. C. elegans oxTi998 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.23). Insertion into F14D7.14. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8938 oxTi999 V. C. elegans oxTi999 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.72). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8939 oxTi1000 IV. C. elegans oxTi1000 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:15.17). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8940 oxTi1001 III. C. elegans oxTi1001 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.45). Insertion into C06G4.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8941 oxTi1002 I. C. elegans oxTi1002 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:19.25). Insertion into Y40B1A.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8942 oxTi1003 X. C. elegans oxTi1003 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.09). Insertion into dhs-30 and T24G12.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8943 oxTi1005. C. elegans oxTi1005 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-14.69). Insertion into srd-69. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8944 oxTi1006 V. C. elegans oxTi1006 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-19.95). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EG8945 oxTi1007 V. C. elegans oxTi1007 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:5.53). Insertion into srd-11. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8946 oxTi1008 IV. C. elegans oxTi1008 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.75). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8947 oxTi1009 I. C. elegans oxTi1009 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.96). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8948 oxTi1010 II. C. elegans oxTi1010 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.79). Insertion into tbc-17. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8949 oxTi1011 II. C. elegans oxTi1011 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-1.99). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8950 oxTi1014 IV. C. elegans oxTi1014 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.62). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8951 oxTi1015 X. C. elegans oxTi1015 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:12.63). Insertion into srd-50. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8952 oxTi1016 I. C. elegans oxTi1016 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.09). Insertion into Y95B8A.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8953 oxTi1017 IV. C. elegans oxTi1017 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.20). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8954 oxTi1018 I. C. elegans oxTi1018 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:21.64). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8955 oxTi1019 X. C. elegans oxTi1019 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-7.36). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8956 oxTi1020 V. C. elegans oxTi1020 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-2.60). Insertion into C04F5.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8957 oxTi1021 V. C. elegans oxTi1021 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.85). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8958 oxTi1022 I. C. elegans oxTi1022 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:22.34). Insertion into Y71A12B.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8959 oxTi1023 IV. C. elegans oxTi1023 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.05). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8960 oxTi1024 III. C. elegans oxTi1024 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.80). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
EG8961 oxSi255 I; oxTi81 him-5(e1490) V. C. elegans oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG I and LG IV. Strain contains him-5(e1490) to generate males for crosses.
EG9615 C. elegans NOT a public strain
EG9631 unc-13(s69) I. C. elegans Aldicarb resistant. This allele is a small exonic deletion that frameshifts exon 21, thus deleting the MUN domain of both long and short isoforms of unc-13. The reference allele e51 is R471-stop, affecting only UNC-13L. Derived by 2x outcross of BC168. Reference: Rose AM & Baillie DL. Genetics. 1980 Nov;96(3):639-48.
EG9747 oxSi1106 II; unc-119(ed3) III. C. elegans oxSi1106 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + lox2272] II. Integrated Cas9 transgene inserted into ttTi5605 MosSci site. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9814 unc-119(ox819) III. C. elegans Crispr/Cas9 engineered mutation in unc-119. ox819 is an 11 bp deletion causing a frameshift after V110 (UNC-119a) and then appends 29 out-of-frame amino acids before a stop codon. unc-119(ox819) animals are phenotypically identical to unc-119(ed3) animals and can be rescued by expression of the smaller C. briggsae unc-119 gene (Cbr-unc-119). Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9876 unc-119(ox819 oxTi1126) III. C. elegans oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9881 unc-119(ox819) F53A2.9(oxTi1127) III. C. elegans oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9882 F53A2.9(oxTi1127) III. C. elegans oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9885 W01A8.6(oxTi1120) I; unc-119(ox819) III. C. elegans oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9887 W01A8.6(oxTi1128) I; unc-119(ox819) III. C. elegans oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9888 W01A8.6(oxTi1128) I. C. elegans oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9891 unc-119(ox819) III; W03F9.11(oxTi1121) V. C. elegans oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
FF275 dpy-17(e164) unc-32(f123) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and embryonic lethals (f123 homozygotes)
FF276 dpy-17(e164) unc-32(f121) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and larval lethals (f121 homozygotes). g to a transition in exon 6 (2874), changing a Gly in Glu in ZK637.8 gene encoding a V-ATPase alpha subunit
JC153 unc-104(ut60)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and unc-104(ut60) animals which are L1 lethal coilers.
MT6977 snt-1(n2665) II. C. elegans Jerky Coiler. Eat-slow pharyngeal pumping.
MT7929 unc-13(e51) I. C. elegans Unc. See WBPaper00003781.
PS6038 unc-119(ed3) III; syEx1136. C. elegans syEx1136 [myo-2p::GFP + unc-119(+)]. unc-119 animal rescued with array that expresses GFP in the pharyngeal muscles. Pick non-Unc animals to maintain the array. Highly outcrossed version of unc-119(ed3) generated by the Sternberg lab. Pick Unc animals for heavily outcrossed unc-119(ed3) to use for out-crossing biolistic insertions, mosSCI insertions or miniMos insertions based on unc-119 selection. Reference: Frokjær-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.
UF64 gqIs37 II; oxIs12 X. C. elegans gqIs37 [unc-47::ppk-1 + myo-2::GFP] II. oxIs12 [unc-47p::GFP + lin-15(+)].
UF65 muIs32 II; gqIs25. C. elegans muIs32 [mec-7p::GFP + lin-15(+)]. gqIs25 [rab-3p::ppk-1 + lin-15(+)].

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
ox278 Allele deletion
ox144 Allele substitution nonsense
ox199 Allele substitution nonsense
ox276 Allele deletion
ox4 Allele
oxSi257 Transposon insertion insertion
oxSi259 Transposon insertion insertion
oxSi346 Transposon insertion insertion
oxTi80 Transposon insertion insertion
oxTi330 Transposon insertion insertion frameshift
oxTi331 Transposon insertion insertion
oxTi333 Transposon insertion
oxTi334 Transposon insertion insertion
oxTi335 Transposon insertion
oxTi417 Transposon insertion insertion
oxTi483 Transposon insertion
oxTi487 Transposon insertion
oxTi467 Transposon insertion
oxTi468 Transposon insertion
oxTi469 Transposon insertion
oxTi470 Transposon insertion
oxTi471 Transposon insertion
oxTi472 Transposon insertion
oxTi473 Transposon insertion
oxTi474 Transposon insertion
oxTi475 Transposon insertion
oxTi476 Transposon insertion
oxTi477 Transposon insertion
oxTi478 Transposon insertion
oxTi480 Transposon insertion
oxTi481 Transposon insertion
oxTi482 Transposon insertion
oxTi485 Transposon insertion
oxTi486 Transposon insertion
oxTi479 Transposon insertion
oxTi392 Transposon insertion insertion
oxTi211 Transposon insertion insertion
oxTi308 Transposon insertion insertion frameshift
oxTi310 Transposon insertion insertion
oxTi648 Transposon insertion
oxTi638 Transposon insertion
oxTi559 Transposon insertion
oxTi556 Transposon insertion
oxTi587 Transposon insertion
oxTi712 Transposon insertion
oxTi718 Transposon insertion
oxTi623 Transposon insertion
oxTi590 Transposon insertion
oxTi302 Transposon insertion insertion
oxTi653 Transposon insertion
oxTi398 Transposon insertion insertion
oxTi413 Transposon insertion insertion
oxTi571 Transposon insertion
oxTi700 Transposon insertion
oxTi723 Transposon insertion
oxTi626 Transposon insertion
oxTi732 Transposon insertion
oxTi730 Transposon insertion
oxTi724 Transposon insertion
oxTi624 Transposon insertion
oxTi628 Transposon insertion
oxTi729 Transposon insertion
oxTi402 Transposon insertion insertion
oxTi677 Transposon insertion
oxTi647 Transposon insertion
oxTi717 Transposon insertion
oxTi726 Transposon insertion
oxTi617 Transposon insertion
oxTi564 Transposon insertion
oxTi394 Transposon insertion insertion
oxTi629 Transposon insertion
oxTi582 Transposon insertion
oxTi540 Transposon insertion
oxTi548 Transposon insertion
oxTi573 Transposon insertion
oxTi609 Transposon insertion
oxTi714 Transposon insertion
oxTi574 Transposon insertion
oxTi722 Transposon insertion
oxTi583 Transposon insertion
oxTi720 Transposon insertion
oxTi296 Transposon insertion insertion
oxTi589 Transposon insertion
oxTi409 Transposon insertion insertion
oxTi657 Transposon insertion
oxTi607 Transposon insertion
oxTi721 Transposon insertion
oxTi399 Transposon insertion insertion
oxTi731 Transposon insertion
oxTi641 Transposon insertion
oxTi706 Transposon insertion
oxTi544 Transposon insertion
oxTi612 Transposon insertion
oxTi615 Transposon insertion
oxTi603 Transposon insertion
oxTi411 Transposon insertion insertion
oxTi627 Transposon insertion
oxTi719 Transposon insertion
oxTi619 Transposon insertion
oxTi734 Transposon insertion
oxTi546 Transposon insertion
oxTi539 Transposon insertion
oxTi713 Transposon insertion
oxTi715 Transposon insertion
oxTi716 Transposon insertion
oxTi390 Transposon insertion insertion
oxTi608 Transposon insertion
oxTi408 Transposon insertion insertion frameshift
oxTi636 Transposon insertion
oxTi670 Transposon insertion
oxTi420 Transposon insertion insertion
oxTi705 Transposon insertion
oxTi397 Transposon insertion insertion frameshift
oxTi563 Transposon insertion
oxTi622 Transposon insertion
oxTi419 Transposon insertion insertion
oxTi208 Transposon insertion insertion
oxTi616 Transposon insertion
oxTi727 Transposon insertion
oxTi584 Transposon insertion
oxTi551 Transposon insertion
oxTi414 Transposon insertion insertion
oxTi537 Transposon insertion
oxTi552 Transposon insertion
oxTi599 Transposon insertion
oxTi611 Transposon insertion
oxTi418 Transposon insertion insertion frameshift
oxTi404 Transposon insertion insertion
oxTi407 Transposon insertion insertion
oxTi602 Transposon insertion
oxTi538 Transposon insertion
oxTi577 Transposon insertion
oxTi592 Transposon insertion
oxTi391 Transposon insertion insertion
oxTi554 Transposon insertion
oxTi581 Transposon insertion
oxTi664 Transposon insertion
oxTi640 Transposon insertion
oxTi654 Transposon insertion
oxTi708 Transposon insertion
oxTi396 Transposon insertion insertion
oxTi393 Transposon insertion insertion
oxTi703 Transposon insertion
oxTi553 Transposon insertion
oxTi543 Transposon insertion
oxTi580 Transposon insertion
oxTi606 Transposon insertion
oxTi620 Transposon insertion
oxTi635 Transposon insertion
oxTi711 Transposon insertion
oxTi630 Transposon insertion
oxTi207 Transposon insertion insertion frameshift
oxTi542 Transposon insertion
oxTi575 Transposon insertion
oxTi725 Transposon insertion
oxTi547 Transposon insertion
oxTi389 Transposon insertion insertion splice_site
oxTi710 Transposon insertion
oxTi405 Transposon insertion insertion
oxTi401 Transposon insertion insertion frameshift
oxTi633 Transposon insertion
oxTi621 Transposon insertion
oxTi597 Transposon insertion
oxTi406 Transposon insertion insertion
oxTi673 Transposon insertion
oxTi651 Transposon insertion
oxTi702 Transposon insertion
oxTi410 Transposon insertion insertion
oxTi675 Transposon insertion
oxTi557 Transposon insertion
oxTi639 Transposon insertion
oxTi728 Transposon insertion
oxTi595 Transposon insertion
oxTi637 Transposon insertion
oxTi566 Transposon insertion
oxTi421 Transposon insertion insertion
oxTi416 Transposon insertion insertion
oxTi704 Transposon insertion
oxTi668 Transposon insertion
oxTi400 Transposon insertion insertion
oxTi594 Transposon insertion
oxTi545 Transposon insertion
oxTi412 Transposon insertion insertion frameshift
oxTi395 Transposon insertion insertion frameshift
oxTi596 Transposon insertion
oxTi403 Transposon insertion insertion
oxTi709 Transposon insertion
oxTi649 Transposon insertion
oxTi659 Transposon insertion
oxTi701 Transposon insertion
oxTi707 Transposon insertion
oxTi550 Transposon insertion
oxTi75 Transposon insertion insertion
oxTi76 insertion
oxTi81 insertion
oxTi185 Transposon insertion
oxTi179 Transposon insertion
oxTi444 Transposon insertion
oxTi177 Transposon insertion
oxTi365 Transposon insertion
oxTi354 Transposon insertion
oxTi79 Transposon insertion insertion
oxTi872 Transposon insertion
oxTi873 Transposon insertion
oxTi874 Transposon insertion
oxTi875 Transposon insertion
oxTi876 Transposon insertion
oxTi877 Transposon insertion
oxTi878 Transposon insertion
oxTi879 Transposon insertion
oxTi880 Transposon insertion
oxTi882 Transposon insertion
oxTi884 Transposon insertion
oxTi885 Transposon insertion
oxTi886 Transposon insertion
oxTi887 Transposon insertion
oxTi888 Transposon insertion
oxTi889 Transposon insertion
oxTi890 Transposon insertion
oxTi891 Transposon insertion
oxTi892 Transposon insertion
oxTi893 Transposon insertion
oxTi894 Transposon insertion
oxTi895 Transposon insertion
oxTi897 Transposon insertion
oxTi898 Transposon insertion
oxTi899 Transposon insertion
oxTi900 Transposon insertion
oxTi901 Transposon insertion
oxTi902 Transposon insertion
oxTi903 Transposon insertion
oxTi904 Transposon insertion
oxTi905 Transposon insertion
oxTi906 Transposon insertion
oxTi907 Transposon insertion
oxTi908 Transposon insertion
oxTi909 Transposon insertion
oxTi910 Transposon insertion
oxTi911 Transposon insertion
oxTi912 Transposon insertion
oxTi914 Transposon insertion
oxTi915 Transposon insertion
oxTi917 Transposon insertion
oxTi918 Transposon insertion
oxTi919 Transposon insertion
oxTi920 Transposon insertion
oxTi921 Transposon insertion
oxTi922 Transposon insertion
oxTi923 Transposon insertion
oxTi924 Transposon insertion
oxTi925 Transposon insertion
oxTi926 Transposon insertion
oxTi927 Transposon insertion
oxTi928 Transposon insertion
oxTi929 Transposon insertion
oxTi930 Transposon insertion
oxTi931 Transposon insertion
oxTi932 Transposon insertion
oxTi933 Transposon insertion
oxTi934 Transposon insertion
oxTi935 Transposon insertion
oxTi936 Transposon insertion
oxTi938 Transposon insertion
oxTi939 Transposon insertion
oxTi940 Transposon insertion
oxTi941 Transposon insertion
oxTi943 Transposon insertion
oxTi944 Transposon insertion
oxTi945 Transposon insertion
oxTi946 Transposon insertion
oxTi947 Transposon insertion
oxTi949 Transposon insertion
oxTi951 Transposon insertion
oxTi953 Transposon insertion
oxTi954 Transposon insertion
oxTi956 Transposon insertion
oxTi957 Transposon insertion
oxTi959 Transposon insertion
oxTi961 Transposon insertion
oxTi962 Transposon insertion
oxTi963 Transposon insertion
oxTi965 Transposon insertion
oxTi966 Transposon insertion
oxTi967 Transposon insertion
oxTi968 Transposon insertion
oxTi969 Transposon insertion
oxTi970 Transposon insertion
oxTi971 Transposon insertion
oxTi973 Transposon insertion
oxTi974 Transposon insertion
oxTi975 Transposon insertion
oxTi976 Transposon insertion
oxTi977 Transposon insertion
oxTi979 Transposon insertion
oxTi980 Transposon insertion
oxTi981 Transposon insertion
oxTi983 Transposon insertion
oxTi984 Transposon insertion
oxTi986 Transposon insertion
oxTi987 Transposon insertion
oxTi988 Transposon insertion
oxTi989 Transposon insertion
oxTi990 Transposon insertion
oxTi991 Transposon insertion
oxTi992 Transposon insertion
oxTi993 Transposon insertion
oxTi994 Transposon insertion
oxTi995 Transposon insertion
oxTi996 Transposon insertion
oxTi997 Transposon insertion
oxTi998 Transposon insertion
oxTi999 Transposon insertion
oxTi1000 Transposon insertion
oxTi1001 Transposon insertion
oxTi1002 Transposon insertion
oxTi1003 Transposon insertion
oxTi1005 Transposon insertion
oxTi1006 Transposon insertion
oxTi1007 Transposon insertion
oxTi1008 Transposon insertion
oxTi1009 Transposon insertion
oxTi1010 Transposon insertion
oxTi1011 Transposon insertion
oxTi1014 Transposon insertion
oxTi1015 Transposon insertion
oxTi1016 Transposon insertion
oxTi1017 Transposon insertion
oxTi1018 Transposon insertion
oxTi1019 Transposon insertion
oxTi1020 Transposon insertion
oxTi1021 Transposon insertion
oxTi1022 Transposon insertion
oxTi1023 Transposon insertion
oxTi1024 Transposon insertion