Laboratory Information
| Name | EG View on WormBase |
|---|---|
| Allele designation | ox |
| Head | Erik Mathias Jorgensen |
| Institution | University of Utah, Salt Lake City |
| Address | University of Utah Biology Dept. Jorgensen Lab, Rm. 201 257 South 1400 East Salt Lake City 84112-0840 United States |
| Website | http://www.biology.utah.edu/jorgensen |
| Gene classes | cpx ocrl ofm pla trx gcc golg rimb rund aipr |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| EG1000 | dpy-5(e61) I; rol-6(e187) II; lon-1(e1820) III. | C. elegans | Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length. |
| EG1020 | bli-6(sc16) IV; dpy-11(e224) V; lon-2(e678) X. | C. elegans | Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length. |
| EG1285 | lin-15B&lin-15A(n765) oxIs12 X. | C. elegans | oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons. |
| EG144 | inx-16(ox144) I. | C. elegans | Pax, Dec-slow (34" defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8. |
| EG1470 | oxEx229. | C. elegans | oxEx229 [Mos1 Substrate + myo-2::GFP]. Should be grown at 25C. |
| EG1642 | lin-15B&lin-15A(n765) X; oxEx166. | C. elegans | oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C. Maintain by picking non-Muv. Animals carrying the array should be GFP+. |
| EG1653 | oxIs22 II. | C. elegans | oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral. |
| EG199 | nas-37(ox199) X. | C. elegans | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. |
| EG2288 | lin-15B&lin-15A(n765) X; oxEx110. | C. elegans | oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv. |
| EG2537 | oxEx344. | C. elegans | oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C. |
| EG2710 | unc-57(ok310) I. | C. elegans | T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu |
| EG276 | exp-1(ox276) II. | C. elegans | Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52. |
| EG2762 | oxEx166. | C. elegans | oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C. |
| EG3027 | unc-26(s1710) IV. | C. elegans | Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping. |
| EG3283 | nas-37(tm410) X. | C. elegans | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga. |
| EG4 | pbo-5(ox4) V. | C. elegans | Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303. |
| EG4181 | C. briggsae wild isolate. | C. briggsae | Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16. |
| EG4207 | C. briggsae wild isolate. | C. briggsae | Mixed "strain" started from many different worms that emerged from the same apricot that gave rise to strain EG4181. Some worms emerged as dauers, but there were also L4s and adults. Consists of a mix of the worms that came from the apricot to try to maintain as much diversity as possible in the population and thus is not a true strain in the traditional sense. It will be sent as contaminated worms since it cannot be cleaned up without going through a bottleneck. |
| EG4322 | ttTi5605 II; unc-119(ed9) III. | C. elegans | Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)] |
| EG4443 | oxIs253 II; unc-119(ed3) III. | C. elegans | oxIs253 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pCFJ68 inserted by MosSCI into ttTi5605 site. |
| EG4601 | oxIs279 II; unc-119(ed3) III. | C. elegans | oxIs279 [pie-1p::GFP::H2B + unc-119(+)]. Wild type. Persistent GFP expression in germline. Visible on dissection microscope. Plasmid pCFJ127 inserted by MosSCI into ttTi5605 site. |
| EG4788 | Caenorhabditis sp. 6 wild isolate. | C. portoensis | Male-female strain. Maintain by mating. Caenorhabditis sp. 6 wild isolate. Isolated by Michael Ailion and Ana-Joao Rodrigues from a rotting apple collected from the home of Anabela Fernandes in Amares, Portugal (address: Dr. Adolofo Vilela, no. 29, 4720-019 Amares, Portugal). Coordinates: 41 degrees, 37', 43.577 " N; 8 degrees, 20', 51.421 " W. Apple collected March 28, 2007. The apple produced a number of growing animals in different stages, including adults of both sexes. Male/Female Caenorhabditis species. 18S RNA sequence places it closest to PS1010 C. sp. 3. |
| EG4813 | lin-15B&lin-15A(n765) X; oxEx1088. | C. elegans | oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type. |
| EG4814 | lin-15B&lin-15A(n765) X; oxEx1089. | C. elegans | oxEx1089 [unc-47p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type. |
| EG4883 | oxIs318 II; unc-119(ed3) III. | C. elegans | oxIs318 [spe-11p::mCherry::histone + unc-119(+)]. Wild type. Dim mCherry expression in hermaphrodite sperm. Barely visible on bright dissection microscope; visible on compound microscope. Plasmid pCFJ167 inserted by MosSCI into ttTi5605 site. |
| EG4887 | oxIs322 II; unc-119(ed3) III. | C. elegans | oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus. |
| EG5003 | unc-119(ed3) III; cxTi10882 IV. | C. elegans | Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). |
| EG5025 | oxIs351 X. | C. elegans | oxIs351 contains [unc-47p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type. |
| EG5027 | oxIs353 V. | C. elegans | oxIs353 contains [myo-3p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type. |
| EG5071 | unc-119(ed3) III; oxIs363 IV. | C. elegans | oxIs363 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pBN04 inserted by MosSCI into cxTi10882 site. |
| EG5096 | oxIs364 X. | C. elegans | oxIs364 contains [unc-17p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type. |
| EG5568 | dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. | C. elegans | dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Dpy, mCherry pharyngeal muscle, dim GFP+ in coelomycytes. Insertion/deletion into cxTi10882 MosSCI site on Chr. IV. Can be used as balancer. |
| EG6032 | ttTi4348 I; unc-18(md299) X. | C. elegans | Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS). |
| EG6053 | oxSi212 II; unc-119(ed3) III. | C. elegans | oxSi212 [pie-1p::GFP::mCherry::H2B::gld-2 3'UTR::operonGFP::H2B::cye-1UTR] II. Maintain under normal conditions; expression is stable. Superficially wildtype. Bright, nuclear mCherry and GFP fluorescence in germline. Reference: Frokjaer-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8. |
| EG6070 | oxSi221 II; unc-119(ed3) III. | C. elegans | oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer. |
| EG6109 | unc-119(ed3) III; oxSi230 X. | C. elegans | oxSi230 [eft-3p::GFP + Cbr-unc-119(+)] X. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi14024 on Chr. X. Can be used as balancer. |
| EG6171 | oxSi257 I; unc-119(ed3) III. | C. elegans | oxSi257 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4391 on Chr. I. Can be used as balancer. |
| EG6173 | oxSi259 I; unc-119(ed3) III. | C. elegans | oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4348 on Chr. I. Can be used as balancer. |
| EG6250 | unc-119(ed3) III; cxTi10882 IV. | C. elegans | Unc. Not caused by cxTi10882. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). Grows best on HB101 bacteria. Reference: Frokjaer-Jensen C, et al., Nat Genet. 2008 Nov;40(11):1375-83. |
| EG6401 | unc-119(ed3) III; oxSi346 IV. | C. elegans | oxSi346 [eft-3p::GFP + Cbr-unc-119(+)] IV. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site cxTi10816 on Chr. IV. Can be used as balancer. |
| EG6629 | oxIs565 II; oxTi80 III; oxSi199 IV. | C. elegans | oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV. |
| EG6699 | ttTi5605 II; unc-119(ed3) III; oxEx1578. | C. elegans | oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.] |
| EG6700 | unc-119(ed3) III; cxTi10882 IV; oxEx1579. | C. elegans | oxEx1579 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. |
| EG6701 | ttTi4348 I; unc-119(ed3) III; oxEx1580. | C. elegans | oxEx1580 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. |
| EG6702 | ttTi4391 I; unc-119(ed3) III; oxEx1581. | C. elegans | oxEx1581 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. |
| EG6703 | unc-119(ed3) III; cxTi10816 IV; oxEx1582. | C. elegans | oxEx1582 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. oxEx1582 array is stable; pick individual animals to obtain Uncs rather than maintaining by chunking. |
| EG6704 | unc-119(ed3) III; ttTi44501 X; oxEx1583. | C. elegans | oxEx1583 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. |
| EG6705 | unc-119(ed3) III; ttTi14024 X; oxEx1584. | C. elegans | oxEx1584 [eft-3p::GFP + Cbr-unc-119]. Pick non-Unc to maintain. Pick Unc to use for injection. |
| EG6787 | oxSi487 II; unc-119(ed3) III. | C. elegans | oxSi487 [mex-5p::mCherry::H2B::tbb-2 3'UTR::gpd-2 operon::GFP::H2B::cye-1 3'UTR + unc-119(+)] II. MosSCI insertion into ttTi5605 site on Chr II. unc-119 rescue, bright nuclear GFP and nuclear mCherry fluorescence in germline. |
| EG7212 | oxTi330 III; gaIs283. | C. elegans | oxTi330 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site. |
| EG7213 | oxTi331 I; gaIs283. | C. elegans | oxTi331 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site. |
| EG7214 | oxTi333 X; gaIs283. | C. elegans | oxTi333 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site. |
| EG7215 | oxTi334; gaIs283. | C. elegans | oxTi334 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site. |
| EG7216 | oxTi335 X; gaIs283. | C. elegans | oxTi335 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site. |
| EG7309 | unc-119(ed3) III; oxTi417 V. | C. elegans | oxTi417 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7340 | oxIs609 X. | C. elegans | oxIs609 [acr-5p::GAP-43::GFP + lin-15(+)] X. GFP localized to axonal membranes of acr-5 expressing neurons. acr-5 promoter drives expression of reporter containing 40 aa myristoylation sequence of GAP43 fused to GFP. oxIs609 was generated by X-ray integration of oxEx81in N2 background. Reference: Rawson RL, et al. Curr Biol. 2014 Mar 31;24(7):760-5. doi: 10.1016/j.cub.2014.02.025. PMID: 24631238. |
| EG7477 | syIs46 II; unc-119(ed3) III; oxTi483 X. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi483 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7478 | syIs46 II; unc-119(ed3) III; oxTi487 X. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi487 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7522 | syIs46 II; oxTi467 unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi467 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified. |
| EG7523 | oxTi468 I; syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi468 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified. |
| EG7524 | syIs46 II; unc-119(ed3) III; oxTi469 IV. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi469 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified. |
| EG7525 | oxTi470 syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi470 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7526 | oxTi471 syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi471 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7527 | oxTi472 syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi472 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7528 | oxTi473 syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi473 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7529 | syIs46 II; unc-119(ed3) III; oxTi474 V. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi474 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490) V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7530 | syIs46 II; unc-119(ed3) III; oxTi475 V. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi475 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7531 | syIs46 II; unc-119(ed3) III; oxTi476 V. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi476 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7532 | syIs46 II; unc-119(ed3) III; oxTi477 IV. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi477 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7533 | syIs46 II; unc-119(ed3) III; oxTi478 V. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi478 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7534 | oxTi480 syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi480 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7535 | oxTi481 I; syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi481 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7536 | syIs46 II; unc-119(ed3) III; oxTi482 IV. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi482 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7538 | syIs46 II; unc-119(ed3) oxTi485 III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi485 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7539 | syIs46 II; unc-119(ed3) III; oxTi486 V. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi486 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7541 | oxTi479 I; syIs46 II; unc-119(ed3) III. | C. elegans | syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi479 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified. |
| EG7565 | unc-119(ed3) III; oxTi392 V. | C. elegans | oxTi392 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7566 | unc-119(ed3) III; oxTi211 V. | C. elegans | oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site. |
| EG7826 | unc-119(ed3) III; oxTi308 X. | C. elegans | oxTi308 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7828 | oxTi310 II; unc-119(ed3) III. | C. elegans | oxTi310 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7831 | oxTi648 I; unc-119(ed3) III. | C. elegans | oxTi648 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7832 | oxTi638 I; unc-119(ed3) III. | C. elegans | oxTi638 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7833 | oxTi559 I; unc-119(ed3) III. | C. elegans | oxTi559 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:-4.48. Please see www.wormbuilder.org for exact insertion site. |
| EG7835 | oxTi556 I; unc-119(ed3) III. | C. elegans | oxTi556 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.23. Please see www.wormbuilder.org for exact insertion site. |
| EG7836 | oxTi587 I; unc-119(ed3) III. | C. elegans | oxTi587 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.28. Please see www.wormbuilder.org for exact insertion site. |
| EG7837 | oxTi712 I; unc-119(ed3) III. | C. elegans | oxTi712 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.29. Please see www.wormbuilder.org for exact insertion site. |
| EG7838 | oxTi718 I; unc-119(ed3) III. | C. elegans | oxTi718 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.07. Please see www.wormbuilder.org for exact insertion site. |
| EG7839 | oxTi623 I; unc-119(ed3) III. | C. elegans | oxTi623 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.75. Please see www.wormbuilder.org for exact insertion site. |
| EG7840 | oxTi590 I; unc-119(ed3) III. | C. elegans | oxTi590 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:3.35. Please see www.wormbuilder.org for exact insertion site. |
| EG7841 | oxTi302 I; unc-119(ed3) III. | C. elegans | oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7842 | oxTi653 I; unc-119(ed3) III. | C. elegans | oxTi653 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7843 | oxTi398 I; unc-119(ed3) III. | C. elegans | oxTi398 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:14.26. Please see www.wormbuilder.org for exact insertion site. |
| EG7844 | oxTi413 I; unc-119(ed3) III. | C. elegans | oxTi413 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:17.17. Please see www.wormbuilder.org for exact insertion site. |
| EG7845 | oxTi571 I; unc-119(ed3) III. | C. elegans | oxTi571 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:21.62. Please see www.wormbuilder.org for exact insertion site. |
| EG7846 | oxTi700 I; unc-119(ed3) III. | C. elegans | oxTi700 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:22.30. Please see www.wormbuilder.org for exact insertion site. |
| EG7847 | oxTi723 I; unc-119(ed3) III. | C. elegans | oxTi723 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:25.79. Please see www.wormbuilder.org for exact insertion site. |
| EG7848 | oxTi626 I; unc-119(ed3) III. | C. elegans | oxTi626 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:29.18. Please see www.wormbuilder.org for exact insertion site. |
| EG7851 | oxTi732 I; unc-119(ed3) III. | C. elegans | oxTi732 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:29.97. Please see www.wormbuilder.org for exact insertion site. |
| EG7854 | oxTi730 I; unc-119(ed3) III. | C. elegans | oxTi730 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7855 | oxTi724 II; unc-119(ed3) III. | C. elegans | oxTi724 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7856 | oxTi624 II; unc-119(ed3) III. | C. elegans | oxTi624 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7857 | oxTi628 II; unc-119(ed3) III. | C. elegans | oxTi628 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7858 | oxTi729 II; unc-119(ed3) III. | C. elegans | oxTi729 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7859 | oxTi402 II; unc-119(ed3) III. | C. elegans | oxTi402 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7860 | oxTi677 II; unc-119(ed3) III. | C. elegans | oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-12.17. Please see www.wormbuilder.org for exact insertion site. |
| EG7862 | oxTi647 II; unc-119(ed3) III. | C. elegans | oxTi647 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7863 | oxTi717 II; unc-119(ed3) III. | C. elegans | oxTi717 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-4.73. Please see www.wormbuilder.org for exact insertion site. |
| EG7864 | oxTi726 II; unc-119(ed3) III. | C. elegans | oxTi726 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-1.02. Please see www.wormbuilder.org for exact insertion site. |
| EG7865 | oxTi617 II; unc-119(ed3) III. | C. elegans | oxTi617 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7866 | oxTi564 II; unc-119(ed3) III. | C. elegans | oxTi564 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7867 | oxTi394 II; unc-119(ed3) III. | C. elegans | oxTi394 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7868 | oxTi629 II; unc-119(ed3) III. | C. elegans | oxTi629 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7869 | oxTi582 II; unc-119(ed3) III. | C. elegans | oxTi582 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7870 | oxTi540 II; unc-119(ed3) III. | C. elegans | oxTi540 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7871 | oxTi548 II; unc-119(ed3) III. | C. elegans | oxTi548 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7872 | oxTi573 II; unc-119(ed3) III. | C. elegans | oxTi573 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7873 | oxTi609 II; unc-119(ed3) III. | C. elegans | oxTi609 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7874 | oxTi714 II; unc-119(ed3) III. | C. elegans | oxTi714 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7875 | oxTi574 II; unc-119(ed3) III. | C. elegans | oxTi574 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7876 | oxTi722 II; unc-119(ed3) III. | C. elegans | oxTi722 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7877 | oxTi583 II; unc-119(ed3) III. | C. elegans | oxTi583 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7878 | oxTi720 II; unc-119(ed3) III. | C. elegans | oxTi720 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7879 | oxTi296 II; unc-119(ed3) III. | C. elegans | oxTi296 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7880 | oxTi589 II; unc-119(ed3) III. | C. elegans | oxTi589 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7881 | oxTi409 II; unc-119(ed3) III; him-5(e1490) V. | C. elegans | oxTi409 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site. |
| EG7882 | oxTi657 II; unc-119(ed3) III. | C. elegans | oxTi657 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7884 | oxTi607 II; unc-119(ed3) III. | C. elegans | oxTi607 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7885 | oxTi721 II; unc-119(ed3) III. | C. elegans | oxTi721 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7886 | oxTi399 II; unc-119(ed3) III. | C. elegans | oxTi399 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7887 | oxTi731 unc-119(ed3) III. | C. elegans | oxTi731 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7888 | oxTi641 unc-119(ed3) III. | C. elegans | oxTi641 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7890 | oxTi706 unc-119(ed3) III. | C. elegans | oxTi706 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7891 | oxTi544 unc-119(ed3) III. | C. elegans | oxTi544 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7892 | oxTi612 unc-119(ed3) III. | C. elegans | oxTi612 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7893 | oxTi615 unc-119(ed3) III. | C. elegans | oxTi615 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7894 | oxTi603 unc-119(ed3) III. | C. elegans | oxTi603 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7895 | oxTi411 unc-119(ed3) III. | C. elegans | oxTi411 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7896 | oxTi627 unc-119(ed3) III. | C. elegans | oxTi627 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7897 | oxTi719 unc-119(ed3) III. | C. elegans | oxTi719 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7898 | oxTi619 unc-119(ed3) III. | C. elegans | oxTi619 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7899 | unc-119(ed3) oxTi734 III. | C. elegans | oxTi734 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7900 | unc-119(ed3) oxTi546 III. | C. elegans | oxTi546 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7901 | unc-119(ed3) oxTi539 III. | C. elegans | oxTi539 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7902 | unc-119(ed3) oxTi713 III. | C. elegans | oxTi713 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7903 | unc-119(ed3) oxTi715 III. | C. elegans | oxTi715 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7904 | unc-119(ed3) III; oxTi716 IV. | C. elegans | oxTi716 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7905 | unc-119(ed3) III; oxTi390 IV. | C. elegans | oxTi390 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7906 | unc-119(ed3) III; oxTi608 IV. | C. elegans | oxTi608 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7907 | unc-119(ed3) III; oxTi408 IV; him-5(e1490) V. | C. elegans | oxTi408 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site. |
| EG7908 | unc-119(ed3) III; oxTi636 IV. | C. elegans | oxTi636 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7909 | unc-119(ed3) III; oxTi670 IV. | C. elegans | oxTi670 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7910 | unc-119(ed3) III; oxTi420 IV. | C. elegans | oxTi420 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7911 | unc-119(ed3) III; oxTi705 IV. | C. elegans | oxTi705 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7912 | unc-119(ed3) III; oxTi397 IV. | C. elegans | oxTi397 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7913 | unc-119(ed3) III; oxTi563 IV. | C. elegans | oxTi563 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7914 | unc-119(ed3) III; oxTi622 IV. | C. elegans | oxTi622 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7915 | unc-119(ed3) III; oxTi419 IV. | C. elegans | oxTi419 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7916 | unc-119(ed3) III; oxTi208 IV. | C. elegans | oxTi208 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site. |
| EG7917 | unc-119(ed3) III; oxTi616 IV. | C. elegans | oxTi616 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7918 | unc-119(ed3) III; oxTi727 IV. | C. elegans | oxTi727 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7919 | unc-119(ed3) III; oxTi584 IV. | C. elegans | oxTi584 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7920 | unc-119(ed3) III; oxTi551 IV. | C. elegans | oxTi551 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. [NOTE (8-17-2016) One researcher has noticed an unusual segregation pattern of the oxTi551 insertion. This strain may contain more than one insertion or is possible mis-mapped - the authors recommend that you verify the location of this insertion prior to using it as a genetic marker.] Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7921 | unc-119(ed3) III; oxTi414 IV. | C. elegans | oxTi414 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7922 | unc-119(ed3) III; oxTi537 IV. | C. elegans | oxTi537 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7923 | unc-119(ed3) III; oxTi552 IV. | C. elegans | oxTi552 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7924 | unc-119(ed3) III; oxTi599 IV. | C. elegans | oxTi599 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7925 | unc-119(ed3) III; oxTi611 IV. | C. elegans | oxTi611 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7926 | unc-119(ed3) III; oxTi418 IV. | C. elegans | oxTi418 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7927 | unc-119(ed3) III; oxTi404 IV. | C. elegans | oxTi404 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7928 | unc-119(ed3) III; oxTi407 IV; him-5(e1490) V. | C. elegans | oxTi407 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site. |
| EG7929 | unc-119(ed3) III; oxTi602 IV. | C. elegans | oxTi602 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7930 | unc-119(ed3) III; oxTi538 IV. | C. elegans | oxTi538 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7931 | unc-119(ed3) III; oxTi577 IV. | C. elegans | oxTi577 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7932 | unc-119(ed3) III; oxTi592 IV. | C. elegans | oxTi592 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7933 | unc-119(ed3) III; oxTi391 IV. | C. elegans | oxTi391 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7934 | unc-119(ed3) III; oxTi554 IV. | C. elegans | oxTi554 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7935 | unc-119(ed3) III; oxTi581 IV. | C. elegans | oxTi581 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7936 | unc-119(ed3) III; oxTi664 V. | C. elegans | oxTi664 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7938 | unc-119(ed3) III; oxTi640 V. | C. elegans | oxTi640 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7939 | unc-119(ed3) III; oxTi654 V. | C. elegans | oxTi654 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7940 | unc-119(ed3) III; oxTi708 V. | C. elegans | oxTi708 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7941 | unc-119(ed3) III; oxTi396 V. | C. elegans | oxTi396 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7942 | unc-119(ed3) III; oxTi393 V. | C. elegans | oxTi393 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7943 | unc-119(ed3) III; oxTi703 V. | C. elegans | oxTi703 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7944 | unc-119(ed3) III; oxTi553 V. | C. elegans | oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7945 | unc-119(ed3) III; oxTi543 V. | C. elegans | oxTi543 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7946 | unc-119(ed3) III; oxTi580 V. | C. elegans | oxTi580 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7947 | unc-119(ed3) III; oxTi606 V. | C. elegans | oxTi606 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7948 | unc-119(ed3) III; oxTi620 V. | C. elegans | oxTi620 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7949 | unc-119(ed3) III; oxTi635 V. | C. elegans | oxTi635 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7950 | unc-119(ed3) III; oxTi711 V. | C. elegans | oxTi711 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7951 | unc-119(ed3) III; oxTi630 V. | C. elegans | oxTi630 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7952 | unc-119(ed3) III; oxTi207 V. | C. elegans | oxTi207 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site. |
| EG7953 | unc-119(ed3) III; oxTi542 V. | C. elegans | oxTi542 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7954 | unc-119(ed3) III; oxTi575 V. | C. elegans | oxTi575 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7955 | unc-119(ed3) III; oxTi725 V. | C. elegans | oxTi725 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7956 | unc-119(ed3) III; oxTi547 V. | C. elegans | oxTi547 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7957 | unc-119(ed3) III; oxTi389 V. | C. elegans | oxTi389 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7958 | unc-119(ed3) III; oxTi710 V. | C. elegans | oxTi710 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7959 | unc-119(ed3) III; him-5(e1490) oxTi405 V. | C. elegans | oxTi405 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] V. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background at Chr. V:8.97. Please see www.wormbuilder.org for exact insertion site. |
| EG7960 | unc-119(ed3) III; oxTi401 V. | C. elegans | oxTi401 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7968 | unc-119(ed3) III; oxTi633 V. | C. elegans | oxTi633 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7969 | unc-119(ed3) III; oxTi621 X. | C. elegans | oxTi621 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7970 | unc-119(ed3) III; oxTi597 X. | C. elegans | oxTi597 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7971 | unc-119(ed3) III; him-5(e1490) V; oxTi406 X. | C. elegans | oxTi406 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Him. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III; him-5(e1490) V background. Please see www.wormbuilder.org for exact insertion site. |
| EG7972 | unc-119(ed3) III; oxTi673 X. | C. elegans | oxTi673 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7975 | unc-119(ed3) III; oxTi651 X. | C. elegans | oxTi651 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7976 | unc-119(ed3) III; oxTi702 X. | C. elegans | oxTi702 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7977 | unc-119(ed3) III; oxTi410 X. | C. elegans | oxTi410 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7978 | unc-119(ed3) III; oxTi675 X. | C. elegans | oxTi675 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7980 | unc-119(ed3) III; oxTi557 X. | C. elegans | oxTi557 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7981 | unc-119(ed3) III; oxTi639 X. | C. elegans | oxTi639 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7982 | unc-119(ed3) III; oxTi728 X. | C. elegans | oxTi728 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7983 | unc-119(ed3) III; oxTi595 X. | C. elegans | oxTi595 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7984 | unc-119(ed3) III; oxTi637 X. | C. elegans | oxTi637 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7985 | unc-119(ed3) III; oxTi566 X. | C. elegans | oxTi566 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7986 | unc-119(ed3) III; oxTi421 X. | C. elegans | oxTi421 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7987 | unc-119(ed3) III; oxTi416 X. | C. elegans | oxTi416 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7988 | unc-119(ed3) III; oxTi704 X. | C. elegans | oxTi704 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7989 | unc-119(ed3) III; oxTi668 X. | C. elegans | oxTi668 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7990 | unc-119(ed3) III; oxTi400 X. | C. elegans | oxTi400 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7991 | unc-119(ed3) III; oxTi594 X. | C. elegans | oxTi594 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7992 | unc-119(ed3) III; oxTi545 X. | C. elegans | oxTi545 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7993 | unc-119(ed3) III; oxTi412 X. | C. elegans | oxTi412 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7994 | unc-119(ed3) III; oxTi395 X. | C. elegans | oxTi395 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7995 | unc-119(ed3) III; oxTi596 X. | C. elegans | oxTi596 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7996 | unc-119(ed3) III; oxTi403 X. | C. elegans | oxTi403 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7998 | unc-119(ed3) III; oxTi709 X. | C. elegans | oxTi709 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG7999 | unc-119(ed3) III; oxTi649 X. | C. elegans | oxTi649 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG8000 | unc-119(ed3) III; oxTi659 X. | C. elegans | oxTi659 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG8001 | unc-119(ed3) III; oxTi701 X. | C. elegans | oxTi701 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG8003 | unc-119(ed3) III; oxTi707 X. | C. elegans | oxTi707 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site. |
| EG8004 | oxTi550 I; unc-119(ed3) III. | C. elegans | oxTi550 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:-18.63. Please see www.wormbuilder.org for exact insertion site. |
| EG8040 | oxTi302 I; oxTi75 II; oxTi411 unc-119(ed3) III; him-8(e1489) IV. | C. elegans | oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]; inserted in Chr. I: 10,166,145. oxTi75 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] II; inserted in Chr. II: 5,448,544. oxTi411 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] inserted in Chr. III: 6,076,837. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information. |
| EG8041 | oxTi76 IV; oxTi405 him-5(e1490) V; oxTi421 X. | C. elegans | oxTi76 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)]; inserted in Chr. IV: 11,899,008. oxTi405 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]; inserted in Chr. V: 15,838,568. oxTi421 [eft-3p::mCherry::tbb-2 3'UTR] inserted in Chr. X: 6,180,397. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information. |
| EG8072 | oxSi259 I; oxIs322 II; oxTi81 V. | C. elegans | oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Cytoplasmic, green fluorescence expressed broadly (most cells). Integration into ttTi4348 mosSCI site (I:-5.32). oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Combined fluorescent balancer strain for LG I, LG II and LG V. |
| EG8073 | oxIs322 II; oxSi199 IV; oxTi81 him-5(e1490) V. | C. elegans | oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG II, LG IV and LG V. Strain contains him-5(e1490) to generate males for crosses. |
| EG8078 | oxTi185 I; unc-119(ed3) III. | C. elegans | oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details. |
| EG8079 | oxTi179 II; unc-119(ed3) III. | C. elegans | oxTi179 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details. |
| EG8080 | oxTi444 unc-119(ed3) III. | C. elegans | oxTi444 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details. |
| EG8081 | unc-119(ed3) III; oxTi177 IV. | C. elegans | oxTi177 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details. |
| EG8082 | unc-119(ed3) III; oxTi365 V. | C. elegans | oxTi365 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details. |
| EG8083 | unc-119(ed3) III; oxTi354 V. | C. elegans | oxTi354 [myo-2p::GFP::H2B + ttTi5605 + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals contain a myo-2p::GFP::H2B construct next to the insertion site and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details. |
| EG8397 | oxIs322 II; oxTi80 III; him-5(e1490) V. | C. elegans | oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses. |
| EG8398 | oxIs322 II; oxTi80 III; oxSi199 IV; him-5(e1490) V. | C. elegans | oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG II, LG III and LG IV. Strain contains him-5(e1490) to generate males for crosses. |
| EG8760 | oxIs322 II; oxTi79 III; him-5(e1490) V. | C. elegans | oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi79 [eft-3p::GFP::H2B::tbb-2 3' UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: -26.22. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses. |
| EG8776 | oxSi255 I; oxIs322 II; oxSi199 IV; him-5(e1490) V. | C. elegans | oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG I, LG II and LG IV. Strain contains him-5(e1490) to generate males for crosses. |
| EG8829 | unc-119(ed3) oxTi872 III. | C. elegans | oxTi872 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-1.41). Insertion into C23G10.7 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8830 | unc-119(ed3) III; oxTi873 IV. | C. elegans | oxTi873 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.44). Insertion into ZK896.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8831 | unc-119(ed3) III; oxTi874 V. | C. elegans | oxTi874 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-13.00). Insertion into srh-36. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8832 | unc-119(ed3) III; oxTi875 V. | C. elegans | oxTi875 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: High percentage of males observed (unpublished observations, Chee Kiang Ewe, Rothman lab, UCSB). NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.19). Insertion into pro-3 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8833 | unc-119(ed3) III; oxTi876 IV. | C. elegans | oxTi876 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.53). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8834 | oxTi877 II; unc-119(ed3) III | C. elegans | oxTi877 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-2.02). Insertion into ggr-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8835 | unc-119(ed3) III; oxTi878 V. | C. elegans | oxTi878 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.58). Insertion into B0507.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8836 | unc-119(ed3) III; oxTi879 V. | C. elegans | oxTi879 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.02). Insertion into H24G06.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8837 | unc-119(ed3) III; oxTi880 IV. | C. elegans | oxTi880 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:1.82). Insertion into drp-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8838 | oxTi882 II; unc-119(ed3) III. | C. elegans | oxTi882 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.13). Insertion into ncRNA C44B7.21. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8839 | unc-119(ed3) III; oxTi884 IV. | C. elegans | oxTi884 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.90). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8840 | unc-119(ed3) III; oxTi885 X. | C. elegans | oxTi885 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:9.13). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8841 | oxTi886 II; unc-119(ed3) III. | C. elegans | oxTi886 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-14.32). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8842 | oxTi887 II; unc-119(ed3) III. | C. elegans | oxTi887 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:2.59). Insertion into T08E11.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8843 | unc-119(ed3) III; oxTi888 V. | C. elegans | oxTi888 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. Pick GFP+ non-Unc to maintain. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:3.88). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8844 | unc-119(ed3) III; oxTi889 V. | C. elegans | oxTi889 [myo-3p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in body wall muscles visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.44). Insertion into F25G6.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1400 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8845 | unc-119(ed3) III; oxTi890 X. | C. elegans | oxTi890 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-0.43). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8846 | oxTi891 II; unc-119(ed3) III. | C. elegans | oxTi891 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-0.61). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8847 | oxTi892 unc-119(ed3) III. | C. elegans | oxTi892 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.93). Insertion into srv-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8848 | unc-119(ed3) III; oxTi893 X. | C. elegans | oxTi893 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:0.57). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8849 | unc-119(ed3) III; oxTi894 V. | C. elegans | oxTi894 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.54). Insertion into srh-131. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8850 | oxTi895 I; unc-119(ed3) III. | C. elegans | oxTi895 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:0.22). Insertion into klp-15. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8851 | oxTi897 unc-119(ed3) III. | C. elegans | oxTi897 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.36). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8852 | unc-119(ed3) III; oxTi898 X. | C. elegans | oxTi898 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.44). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8853 | unc-119(ed3) III; oxTi899 X. | C. elegans | oxTi899 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.63). Insertion into cTel55X. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8854 | unc-119(ed3) III; oxTi900 X. | C. elegans | oxTi900 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-9.39). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8855 | unc-119(ed3) III; oxTi901 V. | C. elegans | oxTi901 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:19.80). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8856 | oxTi902 I; unc-119(ed3) III. | C. elegans | oxTi902 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-1.50). Insertion into anc-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8857 | oxTi903 II; unc-119(ed3) III. | C. elegans | oxTi903 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.15). Insertion into nlp-18. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8858 | oxTi904 II; unc-119(ed3) III. | C. elegans | oxTi904 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.50). Insertion into dyf-13. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8859 | unc-119(ed3) III; oxTi905 X. | C. elegans | oxTi905 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.08). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8860 | unc-119(ed3) III; oxTi906 V. | C. elegans | oxTi906 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:24.52). Insertion into ttx-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8861 | unc-119(ed3) III; oxTi907 V. | C. elegans | oxTi907 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.98). Insertion into srz-92 (pseudogene). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8862 | unc-119(ed3) III; oxTi908 V. | C. elegans | oxTi908 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:12.85). Insertion into sri-70. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8863 | unc-119(ed3) III; oxTi909 IV. | C. elegans | oxTi909 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.02). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8864 | unc-119(ed3) III; oxTi910 X. | C. elegans | oxTi910 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.62). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8865 | unc-119(ed3) III; oxTi911 V. | C. elegans | oxTi911 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:4.95). Insertion into dhc-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8866 | unc-119(ed3) III; oxTi912. | C. elegans | oxTi912 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:14.22). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8867 | unc-119(ed3) III; oxTi914 IV. | C. elegans | oxTi914 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:-25.76). Insertion into F56A11.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8868 | unc-119(ed3) III; oxTi915 IV. | C. elegans | oxTi915 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:-5.63). Insertion into puf-4 (pseudogene). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8869 | oxTi917 I; unc-119(ed3) III. | C. elegans | oxTi917 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:8.72). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8870 | oxTi918 I; unc-119(ed3) III. | C. elegans | oxTi918 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:1.67). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8871 | oxTi919 I; unc-119(ed3) III. | C. elegans | oxTi919 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:13.92). Insertion into sra-25. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8872 | oxTi920 I; unc-119(ed3) III. | C. elegans | oxTi920 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:1.60). Insertion into C30F12.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8873 | unc-119(ed3) III; oxTi921 IV. | C. elegans | oxTi921 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:8.85). Insertion into rab-19. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8874 | unc-119(ed3) III; oxTi922 V. | C. elegans | oxTi922 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:8.58). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8875 | oxTi923 I; unc-119(ed3) III. | C. elegans | oxTi923 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:3.44). Insertion into hgo-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8876 | oxTi924 II; unc-119(ed3) III. | C. elegans | oxTi924 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:22.90). Insertion into srh-42. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8877 | oxTi925 I; unc-119(ed3) III. | C. elegans | oxTi925 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:7.93). Insertion into F36D1.8 (promoter). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8878 | oxTi926 I; unc-119(ed3) III. | C. elegans | oxTi926 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:24.67). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8879 | unc-119(ed3) III; oxTi927 IV. | C. elegans | oxTi927 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:-16.25). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8881 | oxTi929 II; unc-119(ed3) III. | C. elegans | oxTi929 [eft-3p::GFP::2xNLS::tbb-2 3'UTR +Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.16). Insertion into F33A8.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8882 | oxTi930 II; unc-119(ed3) III. | C. elegans | oxTi930 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.05). Insertion into F15A4.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8883 | oxTi931 II; unc-119(ed3) III. | C. elegans | oxTi931 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.49). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8884 | unc-119(ed3) III; oxTi932 X. | C. elegans | oxTi932 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.09). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8885 | unc-119(ed3) III; oxTi933 V. | C. elegans | oxTi933 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:3.38). Insertion into D2023.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8886 | oxTi934 I; unc-119(ed3) III. | C. elegans | oxTi934 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-3.79). Insertion into W05F2.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8887 | oxTi935 unc-119(ed3) III. | C. elegans | oxTi935 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.17). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8888 | unc-119(ed3) III; oxTi936 X. | C. elegans | oxTi936 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-13.81). Insertion into igcm-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8889 | unc-119(ed3) III; oxTi938 IV. | C. elegans | oxTi938 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:2.79). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8890 | oxTi939 II; unc-119(ed3) III. | C. elegans | oxTi939 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.12). Intergenic insertion into snt-1 3' UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8891 | oxTi940 II; unc-119(ed3) III. | C. elegans | oxTi940 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.56). Insertion into C06A8.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8892 | oxTi941 II; unc-119(ed3) III. | C. elegans | oxTi941 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-2.60). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8893 | oxTi943 II; unc-119(ed3) III. | C. elegans | oxTi943 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:20.30). Insertion into histone cluster (non-unique read). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8894 | oxTi944 II; unc-119(ed3) III. | C. elegans | oxTi944 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-17.95). Insertion into C23H3.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8895 | oxTi945 unc-119(ed3) III. | C. elegans | oxTi945 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-15.41). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8896 | oxTi946 I; unc-119(ed3) III. | C. elegans | oxTi946 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:2.69). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8897 | unc-119(ed3) III; oxTi947 V. | C. elegans | oxTi947 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-20.00). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8898 | unc-119(ed3) III; oxTi949 IV. | C. elegans | oxTi949 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.22). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8899 | oxTi951 I; unc-119(ed3) III. | C. elegans | oxTi951 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-0.73). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8900 | unc-119(ed3) III; oxTi953 X. | C. elegans | oxTi953 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-2.45). Insertion into abts-4. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8901 | unc-119(ed3) III; oxTi954 X. | C. elegans | oxTi954 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-7.13). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8902 | oxTi956 unc-119(ed3) III. | C. elegans | oxTi956 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:0.03). Insertion into trxr-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8903 | oxTi957 II; unc-119(ed3) III. | C. elegans | oxTi957 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:3.08). Insertion into mnk-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8904 | oxTi959 I; unc-119(ed3) III. | C. elegans | oxTi959 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:3.91). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8905 | unc-119(ed3) III; oxTi961 V. | C. elegans | oxTi961 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:13.04). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8906 | oxTi962 unc-119(ed3) III. | C. elegans | oxTi962 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.35). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8907 | unc-119(ed3) III; oxTi963 V. | C. elegans | oxTi963 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:12.90). Insertion into srbc-27. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8908 | unc-119(ed3) III; oxTi965 V. | C. elegans | oxTi965 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-2.52). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8909 | unc-119(ed3) III; oxTi966 V. | C. elegans | oxTi966 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:18.45). Insertion into emb-4. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8910 | oxTi967 I; unc-119(ed3) III. | C. elegans | oxTi967 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-1.28). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8911 | unc-119(ed3) III; oxTi968 X. | C. elegans | oxTi968 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-3.89). Insertion into C09B8.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8912 | oxTi969 II; unc-119(ed3) III. | C. elegans | oxTi969 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:18.17). Insertion into lin-38. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8913 | unc-119(ed3) III; oxTi970 IV. | C. elegans | oxTi970 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.92). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8914 | unc-119(ed3) III; oxTi971 IV. | C. elegans | oxTi971 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:11.69). Insertion into Y64G10A.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
| EG8915 | oxTi973 V. | C. elegans | oxTi973 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-19.85). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8916 | oxTi974 II. | C. elegans | oxTi974 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-11.63). Insertion into fbxb-105. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8917 | oxTi975 III. | C. elegans | oxTi975 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.94). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8918 | oxTi976 II. | C. elegans | oxTi976 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.84). Insertion into D2085.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8919 | oxTi977 I. | C. elegans | oxTi977 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:2.42). Insertion into T22C1.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8920 | oxTi979 I. | C. elegans | oxTi979 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:5.06). Insertion into B0205.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8921 | oxTi980 V. | C. elegans | oxTi980 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-18.05). Insertion into srbc-41 promoter. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8922 | oxTi981 I. | C. elegans | oxTi981 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:24.77). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8923 | oxTi983 I. | C. elegans | oxTi983 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-14.58). Insertion into src-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8924 | oxTi984 II. | C. elegans | oxTi984 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.12). Insertion into srh-72. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8925 | oxTi986 X. | C. elegans | oxTi986 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-20.67). Insertion into T08D2.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8926 | oxTi987 V. | C. elegans | oxTi987 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.20). Insertion into dyf-17. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8927 | oxTi988 IV. | C. elegans | oxTi988 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.23). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8928 | oxTi989 III. | C. elegans | oxTi989 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:19.10). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8930 | oxTi991 V. | C. elegans | oxTi991 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:5.59). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8931 | oxTi992 II. | C. elegans | oxTi992 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.96). Insertion into K10B4.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. |
| EG8932 | oxTi993 I. | C. elegans | oxTi993 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:25.92). Insertion into Y105E8B.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8933 | oxTi994 IV. | C. elegans | oxTi994 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:2.45). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8934 | oxTi995 I. | C. elegans | oxTi995 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-0.03). Insertion into pqn-44. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8935 | oxTi996 IV. | C. elegans | oxTi996 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.87). Insertion into mbk-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8936 | oxTi997 V. | C. elegans | oxTi997 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.06). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8937 | oxTi998 V. | C. elegans | oxTi998 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.23). Insertion into F14D7.14. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8938 | oxTi999 V. | C. elegans | oxTi999 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.72). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8939 | oxTi1000 IV. | C. elegans | oxTi1000 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:15.17). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8940 | oxTi1001 III. | C. elegans | oxTi1001 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.45). Insertion into C06G4.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8941 | oxTi1002 I. | C. elegans | oxTi1002 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:19.25). Insertion into Y40B1A.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8942 | oxTi1003 X. | C. elegans | oxTi1003 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.09). Insertion into dhs-30 and T24G12.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8943 | oxTi1005. | C. elegans | oxTi1005 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-14.69). Insertion into srd-69. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8944 | oxTi1006 V. | C. elegans | oxTi1006 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-19.95). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. |
| EG8945 | oxTi1007 V. | C. elegans | oxTi1007 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:5.53). Insertion into srd-11. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8946 | oxTi1008 IV. | C. elegans | oxTi1008 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.75). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8947 | oxTi1009 I. | C. elegans | oxTi1009 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.96). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8948 | oxTi1010 II. | C. elegans | oxTi1010 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.79). Insertion into tbc-17. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8949 | oxTi1011 II. | C. elegans | oxTi1011 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-1.99). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8950 | oxTi1014 IV. | C. elegans | oxTi1014 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.62). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8951 | oxTi1015 X. | C. elegans | oxTi1015 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:12.63). Insertion into srd-50. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8952 | oxTi1016 I. | C. elegans | oxTi1016 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.09). Insertion into Y95B8A.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8953 | oxTi1017 IV. | C. elegans | oxTi1017 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.20). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8954 | oxTi1018 I. | C. elegans | oxTi1018 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:21.64). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8955 | oxTi1019 X. | C. elegans | oxTi1019 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-7.36). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8956 | oxTi1020 V. | C. elegans | oxTi1020 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-2.60). Insertion into C04F5.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8957 | oxTi1021 V. | C. elegans | oxTi1021 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.85). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8958 | oxTi1022 I. | C. elegans | oxTi1022 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:22.34). Insertion into Y71A12B.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8959 | oxTi1023 IV. | C. elegans | oxTi1023 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.05). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8960 | oxTi1024 III. | C. elegans | oxTi1024 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.80). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. |
| EG8961 | oxSi255 I; oxTi81 him-5(e1490) V. | C. elegans | oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG I and LG IV. Strain contains him-5(e1490) to generate males for crosses. |
| EG9631 | unc-13(s69) I. | C. elegans | Aldicarb resistant. This allele is a small exonic deletion that frameshifts exon 21, thus deleting the MUN domain of both long and short isoforms of unc-13. The reference allele e51 is R471-stop, affecting only UNC-13L. Derived by 2x outcross of BC168. Reference: Rose AM & Baillie DL. Genetics. 1980 Nov;96(3):639-48. |
| EG9747 | oxSi1106 II; unc-119(ed3) III. | C. elegans | oxSi1106 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + lox2272] II. Integrated Cas9 transgene inserted into ttTi5605 MosSci site. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9814 | unc-119(ox819) III. | C. elegans | Crispr/Cas9 engineered mutation in unc-119. ox819 is an 11 bp deletion causing a frameshift after V110 (UNC-119a) and then appends 29 out-of-frame amino acids before a stop codon. unc-119(ox819) animals are phenotypically identical to unc-119(ed3) animals and can be rescued by expression of the smaller C. briggsae unc-119 gene (Cbr-unc-119). Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9876 | unc-119(ox819 oxTi1126) III. | C. elegans | oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9881 | unc-119(ox819) F53A2.9(oxTi1127) III. | C. elegans | oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9882 | F53A2.9(oxTi1127) III. | C. elegans | oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9885 | W01A8.6(oxTi1120) I; unc-119(ox819) III. | C. elegans | oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9887 | W01A8.6(oxTi1128) I; unc-119(ox819) III. | C. elegans | oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9888 | W01A8.6(oxTi1128) I. | C. elegans | oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| EG9891 | unc-119(ox819) III; W03F9.11(oxTi1121) V. | C. elegans | oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883 |
| FF275 | dpy-17(e164) unc-32(f123) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. | C. elegans | Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and embryonic lethals (f123 homozygotes) |
| FF276 | dpy-17(e164) unc-32(f121) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. | C. elegans | Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and larval lethals (f121 homozygotes). g to a transition in exon 6 (2874), changing a Gly in Glu in ZK637.8 gene encoding a V-ATPase alpha subunit |
| JC153 | unc-104(ut60)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and unc-104(ut60) animals which are L1 lethal coilers. |
| MT6977 | snt-1(n2665) II. | C. elegans | Jerky Coiler. Eat-slow pharyngeal pumping. |
| MT7929 | unc-13(e51) I. | C. elegans | Unc. See WBPaper00003781. |
| PS6038 | unc-119(ed3) III; syEx1136. | C. elegans | syEx1136 [myo-2p::GFP + unc-119(+)]. unc-119 animal rescued with array that expresses GFP in the pharyngeal muscles. Pick non-Unc animals to maintain the array. Highly outcrossed version of unc-119(ed3) generated by the Sternberg lab. Pick Unc animals for heavily outcrossed unc-119(ed3) to use for out-crossing biolistic insertions, mosSCI insertions or miniMos insertions based on unc-119 selection. Reference: Frokjær-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8. |
| UF64 | gqIs37 II; oxIs12 X. | C. elegans | gqIs37 [unc-47::ppk-1 + myo-2::GFP] II. oxIs12 [unc-47p::GFP + lin-15(+)]. |
| UF65 | muIs32 II; gqIs25. | C. elegans | muIs32 [mec-7p::GFP + lin-15(+)]. gqIs25 [rab-3p::ppk-1 + lin-15(+)]. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| ox278 | Allele | deletion | |
| ox144 | Allele | substitution | nonsense |
| ox199 | Allele | substitution | nonsense |
| ox276 | Allele | deletion | |
| ox4 | Allele | ||
| oxSi257 | Transposon insertion | insertion | |
| oxSi259 | Transposon insertion | insertion | |
| oxSi346 | Transposon insertion | insertion | |
| oxTi80 | Transposon insertion | insertion | |
| oxTi330 | Transposon insertion | insertion | frameshift |
| oxTi331 | Transposon insertion | insertion | |
| oxTi333 | Transposon insertion | ||
| oxTi334 | Transposon insertion | insertion | |
| oxTi335 | Transposon insertion | ||
| oxTi417 | Transposon insertion | insertion | |
| oxTi483 | Transposon insertion | ||
| oxTi487 | Transposon insertion | ||
| oxTi467 | Transposon insertion | ||
| oxTi468 | Transposon insertion | ||
| oxTi469 | Transposon insertion | ||
| oxTi470 | Transposon insertion | ||
| oxTi471 | Transposon insertion | ||
| oxTi472 | Transposon insertion | ||
| oxTi473 | Transposon insertion | ||
| oxTi474 | Transposon insertion | ||
| oxTi475 | Transposon insertion | ||
| oxTi476 | Transposon insertion | ||
| oxTi477 | Transposon insertion | ||
| oxTi478 | Transposon insertion | ||
| oxTi480 | Transposon insertion | ||
| oxTi481 | Transposon insertion | ||
| oxTi482 | Transposon insertion | ||
| oxTi485 | Transposon insertion | ||
| oxTi486 | Transposon insertion | ||
| oxTi479 | Transposon insertion | ||
| oxTi392 | Transposon insertion | insertion | |
| oxTi211 | Transposon insertion | insertion | |
| oxTi308 | Transposon insertion | insertion | frameshift |
| oxTi310 | Transposon insertion | insertion | |
| oxTi648 | Transposon insertion | ||
| oxTi638 | Transposon insertion | ||
| oxTi559 | Transposon insertion | ||
| oxTi556 | Transposon insertion | ||
| oxTi587 | Transposon insertion | ||
| oxTi712 | Transposon insertion | ||
| oxTi718 | Transposon insertion | ||
| oxTi623 | Transposon insertion | ||
| oxTi590 | Transposon insertion | ||
| oxTi302 | Transposon insertion | insertion | |
| oxTi653 | Transposon insertion | ||
| oxTi398 | Transposon insertion | insertion | |
| oxTi413 | Transposon insertion | insertion | |
| oxTi571 | Transposon insertion | ||
| oxTi700 | Transposon insertion | ||
| oxTi723 | Transposon insertion | ||
| oxTi626 | Transposon insertion | ||
| oxTi732 | Transposon insertion | ||
| oxTi730 | Transposon insertion | ||
| oxTi724 | Transposon insertion | ||
| oxTi624 | Transposon insertion | ||
| oxTi628 | Transposon insertion | ||
| oxTi729 | Transposon insertion | ||
| oxTi402 | Transposon insertion | insertion | |
| oxTi677 | Transposon insertion | ||
| oxTi647 | Transposon insertion | ||
| oxTi717 | Transposon insertion | ||
| oxTi726 | Transposon insertion | ||
| oxTi617 | Transposon insertion | ||
| oxTi564 | Transposon insertion | ||
| oxTi394 | Transposon insertion | insertion | |
| oxTi629 | Transposon insertion | ||
| oxTi582 | Transposon insertion | ||
| oxTi540 | Transposon insertion | ||
| oxTi548 | Transposon insertion | ||
| oxTi573 | Transposon insertion | ||
| oxTi609 | Transposon insertion | ||
| oxTi714 | Transposon insertion | ||
| oxTi574 | Transposon insertion | ||
| oxTi722 | Transposon insertion | ||
| oxTi583 | Transposon insertion | ||
| oxTi720 | Transposon insertion | ||
| oxTi296 | Transposon insertion | insertion | |
| oxTi589 | Transposon insertion | ||
| oxTi409 | Transposon insertion | insertion | |
| oxTi657 | Transposon insertion | ||
| oxTi607 | Transposon insertion | ||
| oxTi721 | Transposon insertion | ||
| oxTi399 | Transposon insertion | insertion | |
| oxTi731 | Transposon insertion | ||
| oxTi641 | Transposon insertion | ||
| oxTi706 | Transposon insertion | ||
| oxTi544 | Transposon insertion | ||
| oxTi612 | Transposon insertion | ||
| oxTi615 | Transposon insertion | ||
| oxTi603 | Transposon insertion | ||
| oxTi411 | Transposon insertion | insertion | |
| oxTi627 | Transposon insertion | ||
| oxTi719 | Transposon insertion | ||
| oxTi619 | Transposon insertion | ||
| oxTi734 | Transposon insertion | ||
| oxTi546 | Transposon insertion | ||
| oxTi539 | Transposon insertion | ||
| oxTi713 | Transposon insertion | ||
| oxTi715 | Transposon insertion | ||
| oxTi716 | Transposon insertion | ||
| oxTi390 | Transposon insertion | insertion | |
| oxTi608 | Transposon insertion | ||
| oxTi408 | Transposon insertion | insertion | frameshift |
| oxTi636 | Transposon insertion | ||
| oxTi670 | Transposon insertion | ||
| oxTi420 | Transposon insertion | insertion | |
| oxTi705 | Transposon insertion | ||
| oxTi397 | Transposon insertion | insertion | frameshift |
| oxTi563 | Transposon insertion | ||
| oxTi622 | Transposon insertion | ||
| oxTi419 | Transposon insertion | insertion | |
| oxTi208 | Transposon insertion | insertion | |
| oxTi616 | Transposon insertion | ||
| oxTi727 | Transposon insertion | ||
| oxTi584 | Transposon insertion | ||
| oxTi551 | Transposon insertion | ||
| oxTi414 | Transposon insertion | insertion | |
| oxTi537 | Transposon insertion | ||
| oxTi552 | Transposon insertion | ||
| oxTi599 | Transposon insertion | ||
| oxTi611 | Transposon insertion | ||
| oxTi418 | Transposon insertion | insertion | frameshift |
| oxTi404 | Transposon insertion | insertion | |
| oxTi407 | Transposon insertion | insertion | |
| oxTi602 | Transposon insertion | ||
| oxTi538 | Transposon insertion | ||
| oxTi577 | Transposon insertion | ||
| oxTi592 | Transposon insertion | ||
| oxTi391 | Transposon insertion | insertion | |
| oxTi554 | Transposon insertion | ||
| oxTi581 | Transposon insertion | ||
| oxTi664 | Transposon insertion | ||
| oxTi640 | Transposon insertion | ||
| oxTi654 | Transposon insertion | ||
| oxTi708 | Transposon insertion | ||
| oxTi396 | Transposon insertion | insertion | |
| oxTi393 | Transposon insertion | insertion | |
| oxTi703 | Transposon insertion | ||
| oxTi553 | Transposon insertion | ||
| oxTi543 | Transposon insertion | ||
| oxTi580 | Transposon insertion | ||
| oxTi606 | Transposon insertion | ||
| oxTi620 | Transposon insertion | ||
| oxTi635 | Transposon insertion | ||
| oxTi711 | Transposon insertion | ||
| oxTi630 | Transposon insertion | ||
| oxTi207 | Transposon insertion | insertion | frameshift |
| oxTi542 | Transposon insertion | ||
| oxTi575 | Transposon insertion | ||
| oxTi725 | Transposon insertion | ||
| oxTi547 | Transposon insertion | ||
| oxTi389 | Transposon insertion | insertion | splice_site |
| oxTi710 | Transposon insertion | ||
| oxTi405 | Transposon insertion | insertion | |
| oxTi401 | Transposon insertion | insertion | frameshift |
| oxTi633 | Transposon insertion | ||
| oxTi621 | Transposon insertion | ||
| oxTi597 | Transposon insertion | ||
| oxTi406 | Transposon insertion | insertion | |
| oxTi673 | Transposon insertion | ||
| oxTi651 | Transposon insertion | ||
| oxTi702 | Transposon insertion | ||
| oxTi410 | Transposon insertion | insertion | |
| oxTi675 | Transposon insertion | ||
| oxTi557 | Transposon insertion | ||
| oxTi639 | Transposon insertion | ||
| oxTi728 | Transposon insertion | ||
| oxTi595 | Transposon insertion | ||
| oxTi637 | Transposon insertion | ||
| oxTi566 | Transposon insertion | ||
| oxTi421 | Transposon insertion | insertion | |
| oxTi416 | Transposon insertion | insertion | |
| oxTi704 | Transposon insertion | ||
| oxTi668 | Transposon insertion | ||
| oxTi400 | Transposon insertion | insertion | |
| oxTi594 | Transposon insertion | ||
| oxTi545 | Transposon insertion | ||
| oxTi412 | Transposon insertion | insertion | frameshift |
| oxTi395 | Transposon insertion | insertion | frameshift |
| oxTi596 | Transposon insertion | ||
| oxTi403 | Transposon insertion | insertion | |
| oxTi709 | Transposon insertion | ||
| oxTi649 | Transposon insertion | ||
| oxTi659 | Transposon insertion | ||
| oxTi701 | Transposon insertion | ||
| oxTi707 | Transposon insertion | ||
| oxTi550 | Transposon insertion | ||
| oxTi75 | Transposon insertion | insertion | |
| oxTi76 | insertion | ||
| oxTi81 | insertion | ||
| oxTi185 | Transposon insertion | ||
| oxTi179 | Transposon insertion | ||
| oxTi444 | Transposon insertion | ||
| oxTi177 | Transposon insertion | ||
| oxTi365 | Transposon insertion | ||
| oxTi354 | Transposon insertion | ||
| oxTi79 | Transposon insertion | insertion | |
| oxTi872 | Transposon insertion | ||
| oxTi873 | Transposon insertion | ||
| oxTi874 | Transposon insertion | ||
| oxTi875 | Transposon insertion | ||
| oxTi876 | Transposon insertion | ||
| oxTi877 | Transposon insertion | ||
| oxTi878 | Transposon insertion | ||
| oxTi879 | Transposon insertion | ||
| oxTi880 | Transposon insertion | ||
| oxTi882 | Transposon insertion | ||
| oxTi884 | Transposon insertion | ||
| oxTi885 | Transposon insertion | ||
| oxTi886 | Transposon insertion | ||
| oxTi887 | Transposon insertion | ||
| oxTi888 | Transposon insertion | ||
| oxTi889 | Transposon insertion | ||
| oxTi890 | Transposon insertion | ||
| oxTi891 | Transposon insertion | ||
| oxTi892 | Transposon insertion | ||
| oxTi893 | Transposon insertion | ||
| oxTi894 | Transposon insertion | ||
| oxTi895 | Transposon insertion | ||
| oxTi897 | Transposon insertion | ||
| oxTi898 | Transposon insertion | ||
| oxTi899 | Transposon insertion | ||
| oxTi900 | Transposon insertion | ||
| oxTi901 | Transposon insertion | ||
| oxTi902 | Transposon insertion | ||
| oxTi903 | Transposon insertion | ||
| oxTi904 | Transposon insertion | ||
| oxTi905 | Transposon insertion | ||
| oxTi906 | Transposon insertion | ||
| oxTi907 | Transposon insertion | ||
| oxTi908 | Transposon insertion | ||
| oxTi909 | Transposon insertion | ||
| oxTi910 | Transposon insertion | ||
| oxTi911 | Transposon insertion | ||
| oxTi912 | Transposon insertion | ||
| oxTi914 | Transposon insertion | ||
| oxTi915 | Transposon insertion | ||
| oxTi917 | Transposon insertion | ||
| oxTi918 | Transposon insertion | ||
| oxTi919 | Transposon insertion | ||
| oxTi920 | Transposon insertion | ||
| oxTi921 | Transposon insertion | ||
| oxTi922 | Transposon insertion | ||
| oxTi923 | Transposon insertion | ||
| oxTi924 | Transposon insertion | ||
| oxTi925 | Transposon insertion | ||
| oxTi926 | Transposon insertion | ||
| oxTi927 | Transposon insertion | ||
| oxTi928 | Transposon insertion | ||
| oxTi929 | Transposon insertion | ||
| oxTi930 | Transposon insertion | ||
| oxTi931 | Transposon insertion | ||
| oxTi932 | Transposon insertion | ||
| oxTi933 | Transposon insertion | ||
| oxTi934 | Transposon insertion | ||
| oxTi935 | Transposon insertion | ||
| oxTi936 | Transposon insertion | ||
| oxTi938 | Transposon insertion | ||
| oxTi939 | Transposon insertion | ||
| oxTi940 | Transposon insertion | ||
| oxTi941 | Transposon insertion | ||
| oxTi943 | Transposon insertion | ||
| oxTi944 | Transposon insertion | ||
| oxTi945 | Transposon insertion | ||
| oxTi946 | Transposon insertion | ||
| oxTi947 | Transposon insertion | ||
| oxTi949 | Transposon insertion | ||
| oxTi951 | Transposon insertion | ||
| oxTi953 | Transposon insertion | ||
| oxTi954 | Transposon insertion | ||
| oxTi956 | Transposon insertion | ||
| oxTi957 | Transposon insertion | ||
| oxTi959 | Transposon insertion | ||
| oxTi961 | Transposon insertion | ||
| oxTi962 | Transposon insertion | ||
| oxTi963 | Transposon insertion | ||
| oxTi965 | Transposon insertion | ||
| oxTi966 | Transposon insertion | ||
| oxTi967 | Transposon insertion | ||
| oxTi968 | Transposon insertion | ||
| oxTi969 | Transposon insertion | ||
| oxTi970 | Transposon insertion | ||
| oxTi971 | Transposon insertion | ||
| oxTi973 | Transposon insertion | ||
| oxTi974 | Transposon insertion | ||
| oxTi975 | Transposon insertion | ||
| oxTi976 | Transposon insertion | ||
| oxTi977 | Transposon insertion | ||
| oxTi979 | Transposon insertion | ||
| oxTi980 | Transposon insertion | ||
| oxTi981 | Transposon insertion | ||
| oxTi983 | Transposon insertion | ||
| oxTi984 | Transposon insertion | ||
| oxTi986 | Transposon insertion | ||
| oxTi987 | Transposon insertion | ||
| oxTi988 | Transposon insertion | ||
| oxTi989 | Transposon insertion | ||
| oxTi990 | Transposon insertion | ||
| oxTi991 | Transposon insertion | ||
| oxTi992 | Transposon insertion | ||
| oxTi993 | Transposon insertion | ||
| oxTi994 | Transposon insertion | ||
| oxTi995 | Transposon insertion | ||
| oxTi996 | Transposon insertion | ||
| oxTi997 | Transposon insertion | ||
| oxTi998 | Transposon insertion | ||
| oxTi999 | Transposon insertion | ||
| oxTi1000 | Transposon insertion | ||
| oxTi1001 | Transposon insertion | ||
| oxTi1002 | Transposon insertion | ||
| oxTi1003 | Transposon insertion | ||
| oxTi1005 | Transposon insertion | ||
| oxTi1006 | Transposon insertion | ||
| oxTi1007 | Transposon insertion | ||
| oxTi1008 | Transposon insertion | ||
| oxTi1009 | Transposon insertion | ||
| oxTi1010 | Transposon insertion | ||
| oxTi1011 | Transposon insertion | ||
| oxTi1014 | Transposon insertion | ||
| oxTi1015 | Transposon insertion | ||
| oxTi1016 | Transposon insertion | ||
| oxTi1017 | Transposon insertion | ||
| oxTi1018 | Transposon insertion | ||
| oxTi1019 | Transposon insertion | ||
| oxTi1020 | Transposon insertion | ||
| oxTi1021 | Transposon insertion | ||
| oxTi1022 | Transposon insertion | ||
| oxTi1023 | Transposon insertion | ||
| oxTi1024 | Transposon insertion |