Search Strains

More Fields
Strain Species Genotype Add
RG3489 C. elegans rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.