| RG3416 |
C. elegans |
prx-2(ve916[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. ve916 homozygotes are thin, slow-growing, lay small, slow-growing broods. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow growing hermaphrodites that can be maintained as a homozygous slow growing population (ve916 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Deletion of 1288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCCAATAATACACTACACTGTACCCT; Right flanking sequence: TGGTCATTCTACAATAACTGAAAGCATTTT. prx-2 sgRNA A: AGGAATAGTGATAGTGGGGG; prx-2 sgRNA B: CTCTATTTCCTTCGATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
