| RG3511 |
C. elegans |
sars-1(ve1011[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Early larval arrest. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1011 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatcattaaaaacattgccaacagttgaa; Right flanking sequence: AGgtatatataaaacttattatactaaacg. sars-1 crRNA A: aaacagtatcgaagttaagG; sars-1 crRNA B: GACCAAGAAACTGAGTGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|