Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
TG4103 C. elegans ttr-33(gt1983) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
TG4281 C. elegans unc-119(ed3) III; cxTi10816 IV; gtEx4170. Show Description
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
VH7214 C. elegans +/nT1 [umnls49] IV; ttr-33(hd7205[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7205 and CGC63. hd7205 is a 672 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GACTCGAACTCAATTTGCATGTTGATAGTT; Right flanking sequence: TGGTTAGAAAAAGATACGGAGAGGAGAAGT. sgRNA #1: CCAATGTTAAAGAAAGTCTT; sgRNA #2: AAACTCTCTTATAGCACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.