Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AH3437 C. elegans tln-1(zh117[gfp::tln-1]) I. Show Description
Wild-type morphology. Endogenous GFP reporter for tln-1. Reference: Walser M, et al. PLoS Genet. 2017 Jan 30;13(1):e1006592.
DR49 C. elegans tln-1(e259) I. Show Description
Unc. Weakly semi-dominant. Scored with difficulty.
RB1445 C. elegans Y71G12B.11(ok1648) I. Show Description
Y71G12B.11 Homozygous. Outer Left Sequence: tgaagtggtggctcttgttg. Outer Right Sequence: aagttccgtttgttggttgc. Inner Left Sequence: tggtttctaaggggttgcag. Inner Right Sequence: gcgcttctctcaatttgtcc. Inner Primer PCR Length: 3151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DA1075 C. elegans tln-1(e259) dpy-5(e61) I. Show Description
Dpy. Unc.
VC4464 C. elegans atln-1(gk5537[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4161 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCTCCATTATCCGGATTCTCGTGGCGT; Right flanking sequence: TGGAACGGTTGGAATCTGATTTGCAGGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.