| JJ1550 |
C. elegans |
dpl-1(zu355) unc-4(e120)/rol-6(e187) let-23(sy97) II. Show Description
Heterozygotes are WT and segregate WT, Uncs which give only deads egss with a Mex phenotype, and Vulvaless Rollers. sy97 is only 15% viable.
|
|
| PS295 |
C. elegans |
let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS746 |
C. elegans |
let-23(sy97) II; sli-1(sy143) X. Show Description
sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5332 |
C. elegans |
unc-119(ed4) III; him-5(e1490) V; syIs187. Show Description
syIs187 [pes-10::7XTCF-mCherry-let-858(3'UTR) + unc-119(+)]. Cherry POPTOP. POPTOP expression is best visualized using the mCherry/Texas Red filter. POPTOP transgenes display background expression. POPFOP(sy974) is the control plasmid with mutated binding sites. Analysis of POPFOP should always be used to subtract background expression. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS8203 |
C. elegans |
affl-2(sy975) Y55B1BR.1(sy1220) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975);
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC
Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. affl-2 formerly known as sup-45.
|
|