Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DR631 C. elegans unc-54(e190) I; sus-1(m156) III. Show Description
Severly paralyzed Unc. More severe than unc-15 alone.
DR632 C. elegans unc-15(e73) I; sus-1(m156) III. Show Description
Severly ill and paralyzed. Lays few eggs. More severe than unc-15 alone.
DR373 C. elegans unc-15(e73) I; sus-1(m156) III; eDp23 V. Show Description
Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).
DR629 C. elegans unc-15(e73) I; sus-1(m156) daf-2(e1370) III; eDp23 V. Show Description
Temperature sensitive dauers. Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).
RG3054 C. elegans sue-1(ve554[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 10676 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaattttgtgggaataaacgcacaccgcga ; Right flanking sequence: caaggtgaaaaagaaaacaaatagttactg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.