| CB4507 |
C. elegans |
C. elegans wild isolate. Show Description
Wild isolate from Palm Canyon, CA. Segregated to remove gro-1(e2400) [CB4512]. Caenorhabditis elegans wild isolate CB gro-1(+) subclone of PaC1 (Tc1 pattern IV). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4512 |
C. elegans |
gro-1(e2400) III. Show Description
Slow growing. Homozygous gro-1(e2400) derived from PaC-1 (CB4507). Caenorhabditis elegans wild isolate CB subclone of PaC1 (Tc1 pattern IV?)]. |
|
| CB4555 |
C. elegans |
C. elegans wild isolate. Show Description
Wild isolate from Pasadena, Ca. [Flower bed on CIT campus in summer of 1971 (or 1973??). Wild type phenotype. High copy Tc1. Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. CB subclone of PA1 (Tc1 pattern HCG?). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4851 |
C. elegans |
C. elegans wild isolate. Show Description
Wild type-slightly Unc. Tc1 pattern high copy; different from RW7000. Bergerac isolate obtained by S. Brenner from Brun group. Caenorhabditis elegans wild isolate. CB subclone of Bergerac N62 (Tc1 pattern HCB). To obtain ECA243, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4852 |
C. elegans |
C. elegans wild isolate. Show Description
Wild type. Low Tc1 copy number; pattern X. [Obtained from Rothamsted by S. Brenner as 'Panagrellus redivivus'. Cross fertile with C. elegans N2.] Caenorhabditis elegans wild isolate. CB subclone of N3 (Tc1 pattern X). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4853 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1; pattern III. Caenorhabditis elegans wild isolate. CB subclone of GA-12 (Tc1 pattern III). To obtain ECA245, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4854 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1, pattern V. Caenorhabditis elegans wild isolate. CB subclone of GA-9 (Tc1 pattern V). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4855 |
C. elegans |
C. elegans wild isolate. Show Description
NOTE: Whole-genome analysis indicates that this stock is genotypically CB4858. Users interested in this strain are encouraged to obtain a verified CB4855-derivied strain. To obtain ECA247, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). Isolated from compost in Palo Alto, CA in 1982(?). Wild type (plg-1(e2001)). Low copy Tc1, pattern VI. Caenorhabditis elegans wild isolate CB subclone of Sta-5 (Tc1 pattern VI). Original stock isolated by T. Doniach. |
|
| CB4856 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated from a pineapple field in Hawaii in 1972 by L. Hollen. Wild type. Low copy Tc1; pattern IX. C. elegans wild isolate. CB subclone of HA-8 (Tc1 pattern IX). See also WBPaper00005369. [NOTE (4-2014): Users reported abnormalities in CB4856 in late 2013 and early 2014. The current working stock at the CGC was thawed in 2-2014 from stock frozen in 1995.] For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4857 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated from decaying mushroom during rain in Claremont, CA in November 1972. Wild type. Low copy Tc1, pattern II. Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. CB subclone of Cl2a (Tc1 pattern II). To obtain ECA249, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| CB4858 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated from Caltech flowerbed in the summer of 1971 (1973??) in Pasadena, CA. Wild type. Low copy Tc1; pattern XI. Caenorhabditis elegans wild isolate. EM subclone of PA1 (Tc1 pattern XI). To obtain ECA251, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DH1300 |
C. briggsae |
C. briggsae wild isolate. Show Description
DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DP13 |
C. elegans |
C. elegans wild isolate. Show Description
For PCR STS mapping. Differs from RW7000 in two Tc1 sites. Caenorhabditis elegans wild isolate. DP subclone of RW7000. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DR1344 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141. Previously called Bergerac LY and Bergerac BO. Caenorhabditis elegans wild isolate. DR subclone of Bergerac BO (Tc1 pattern HCA). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DR1345 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 104-141 and 11(5) 60. Caenorhabditis elegans wild isolate. DR subclone of Cl2a (Tc1 pattern II). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DR1346 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of GA-1 (Tc1 pattern I). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DR1347 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of GA-1 (Tc1 pattern I). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DR1348 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of GA-1 (Tc1 pattern I). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DR1349 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. DR subclone of PA-1. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| DR1350 |
C. elegans |
C. elegans wild isolate. Show Description
Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of PA-2 (Tc1 pattern III). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). |
|
| N2 |
C. elegans |
C. elegans wild isolate. Show Description
C. elegans var Bristol. Generation time is about 3 days. Brood size is about 350. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: This stock might carry a ~1.8 kb deletion in alh-2 in the background. (UPDATE: 03/26/2018 - a user reported the stock they received was homozygous for the alh-2(ot588) mutation.)] |
|
| N2 Male |
C. elegans |
C. elegans wild isolate. Show Description
C. elegans var Bristol. Self-fertilizing hermaphrodite. Generation time is about 3.5 days at 20C. Male stock maintained by mating. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: (09/07/2018) The Gems Lab has identified a mutation in the gene fln-2 carried in this stock causing an increased lifespan. The effect is quite modest (+11%, median lifespan), but this effect can be more pronounced in other genetic backgrounds.] [NOTE: (03/26/2018) - a user reported the stock they received was homozygous wild-type for alh-2; some N2 stocks carry the ot588 mutation in alh-2.) |
|
| NL1787 |
C. elegans |
unc-13(e51) I. NL subclone of KR1787. Show Description
NL subclone of KR1787. NL received strain KR1787 from Ann Rose 11/93. High copy Tc1 strain. See WBG 14(4): 16-17. |
|
| NL4000 |
C. elegans |
sma-1(e30) V. NL subclone of CB4000. Show Description
NL subclone of CB4000. High Tc1 copy number strain. See WBG 14(4): 16-17. |
|
| NL7000 |
C. elegans |
NL subclone of RW7000 Bergerac BO. Show Description
NL subclone of strain RW7000. NL7000 seems to have diverged from RW7000 strains in other labs. Some polymorphisms are different; the two strains may actually be quite diverged. NL received RW7000 in 1988. See WBG 14(4): 16-17. Rec'd new stock 5/97 from NL. |
|
| PD4251 |
C. elegans |
ccIs4251 I; dpy-20(e1282) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts). |
|
| RW6999 |
C. elegans |
C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. RW subclone of Bergerac BO (Tc1 pattern HCA). |
|
| RW7000 |
C. elegans |
C. elegans wild isolate. Show Description
PCR STS mapping standard strain. Caenorhabditis elegans wild isolate. RW subclone of Bergerac BO (Tc1 pattern HCA). |
|
| ALF62 |
C. elegans |
bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. |
|
| ALF63 |
C. elegans |
unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. |
|
| ALF82 |
C. elegans |
unc-119(ed3) III; daf-12(rh61rh411) X; bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Array was crossed into strain ALF3 to create ALF82. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. |
|
| DRb546 |
Escherichia coli |
E. coli Show Description
Bacteria. Ampicillin & tetracycline resistant. E. coli HT115(DE3) strain carrying pREW2 plasmid expressing dsRNA luciferase. Can be used as a negative control for RNAi experiments in lieu of empty vector. Fragment of luciferase coding sequence was subcloned into L4440 to produce pREW2. Sequence inserted into pPD129.36(L4440) HindIII - XhoI sites: "cataaagaaaggcccggcgccattctatcctctagaggatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtgaacatcacgtacgcggaatacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgc" Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. PMID: 30184501. |
|
| GN112 |
C. elegans |
pgIs2. Show Description
pgIs2 [gcy-8p::TU#813 + gcy-8p::TU#814 + unc-122p::GFP + gcy-8p::mCherry + gcy-8p::GFP + ttx-3p::GFP]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gcy-8 promoter. Expression of GFP in coelomocytes and AIY neuron, and mCherry in AFD neuron when caspase activity is lost. Reference: Glauser DA, et al. Genetics. 2011 May;188(1):91-103. |
|
| OP50/cytR- |
Escherichia coli |
E. coli [cytR-] Show Description
Bacteria. Kanamycin-resistant E. coli. cytR- mutation in OP50 background causes elavated nucleotide levels similar to HT115. A mutation in CytR- was introduced into the OP50 strain by recombineering. Bacterial cells were transformed with pSIM8 plasmid before using as hosts for recombineering. Targeting substrate DNA fragments were amplified by PCR and subcloned into TOPO cloning vector for sequence verification before being electroporated into the host bacterial cells. The primer set used for cloning targeting cytR substrate DNAs (to replace cytR+ with the cytR- mutation identified in HT115 strain): 5'- GCCAGGCGAGGAGTGAGTGTG-3'/5'-AGCGGCGGGCCTTTGACC-3'. Reference: Chi C, et al. Genes Dev. 2016 Feb 1;30(3):307-20. |
|
| PY7502 |
C. elegans |
oyIs85. Show Description
oyIs85 [ceh-36p::TU#813 + ceh-36p::TU#814 + srtx-1p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the ceh-36 promoter. AWC ablated in this strain. Defective thermotaxis. Expression of dsRed in coelomocytes. GFP expression in AFD. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27. |
|
| PY7505 |
C. elegans |
oyIs84. Show Description
oyIs84 [gpa-4p::TU#813 + gcy-27p::TU#814 + gcy-27p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gpa-4 promoter and gcy-27 promoter, respectively. ASI is ablated in this strain. Increased dauer formation. Expression of dsRed in coelomocytes. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27. |
|