Strain Information
| Name | DRb546 View On Wormbase |
|---|---|
| Species | Escherichia coli |
| Genotype | E. coli |
| Description | Bacteria. E. coli HT115(DE3) strain carrying pREW2 plasmid expressing dsRNA luciferase. Can be used as a negative control for RNAi experiments in lieu of empty vector. Fragment of luciferase coding sequence was subcloned into L4440 to produce pREW2. Sequence inserted into pPD129.36(L4440) HindIII - XhoI sites:"cataaagaaaggcccggcgccattctatcctctagaggatggaaccgctggagagcaac tgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcac atatcgaggtgaacatcacgtacgcggaatacttcgaaatgtccgttcggttggcagaag ctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctc ttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgc" Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. PMID: 30184501. |
| Mutagen | No mutagen |
| Outcrossed | xNA |
| Made by | Rebcca EW Kaplan |
| Laboratory | DV |
| Reference | Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. PMID: 30184501. |
Sign in
or
register an account if you want to order this strain.