Strain Information

Name DRb546   View On Wormbase
Species Escherichia coli
GenotypeE. coli
DescriptionBacteria. E. coli HT115(DE3) strain carrying pREW2 plasmid expressing dsRNA luciferase. Can be used as a negative control for RNAi experiments in lieu of empty vector. Fragment of luciferase coding sequence was subcloned into L4440 to produce pREW2. Sequence inserted into pPD129.36(L4440) HindIII - XhoI sites:"cataaagaaaggcccggcgccattctatcctctagaggatggaaccgctggagagcaac
tgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcac
atatcgaggtgaacatcacgtacgcggaatacttcgaaatgtccgttcggttggcagaag
ctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctc
ttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgc"
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. PMID: 30184501.
MutagenNo mutagen
OutcrossedxNA
Made byRebcca EW Kaplan
Laboratory DV
Reference Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. PMID: 30184501.
Sign in or register an account if you want to order this strain.