Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
NL3643 C. elegans unc-22(st136) IV. Show Description
Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.
RW7080 C. elegans mut-4(st700) I; mut-5(st701) II; unc-22(st136) IV. Show Description
Uncoordinated Twitchers, moves slowly with constant twitching. Thin. Egl. Mutators give spontaneous reversion of unc-22.
SX157 C. elegans prg-1(n4357) I; unc-22(st136) IV. Show Description
Transposon silencing normal.
SX166 C. elegans prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. Show Description
Transposon silencing normal.
DR842 C. elegans mut-4(st700) I; mut-5(st701) II; unc-22(st136m498) IV. Show Description
Non-Twitchers. Still contains Tc1. Temperature sensitive. Sterile at 25C, grows ok at 20C. Dauer larvae are SDS resistant.