Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
OH16482 C. elegans rpc-1(ot1041[rpc-1::gfp::3xflag]) IV. Show Description
Superficially wild-type.
MCJ666 C. elegans ieSi57 II; rpc-1(cdb434[rpc-1::3xFLAG::AID*]) ieSi38 IV. Show Description
3xFLAG tag and AID* degron inserted at C-terminus of endogenous rpc-1 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. Made by CRISPR modification of parental strain MLC1040. sgRNA #1: CGGCGAATTCTGTTTAAGAA; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.
RG3472 C. elegans rpc-1(ve972[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested early larvae (ve972 homozygotes, rare escapers are fertile adults), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTTCCATGAGCAACAATTTTACATCCT; Right flanking sequence: CGGCTTTTTTTACGGTTCctgaatacaaaa. rpc-1 crRNA A: AAAGTGTGTCCACAGATGAG; rpc-1 crRNA B: AATCTTCAGAACTGCTCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.