| CB4043 |
C. elegans |
smg-2(e2008) I; him-5(e1490) V. Show Description
e2008 recessively suppresses the phenotypes of mutations in unc-54(r293), lin-29(n546), tra-2 and dpy-5. Abnormal male tail. smg-2 homozygotes have slightly abnormal movement.
|
|
| CZ3086 |
C. elegans |
kin-1(ok338)/unc-54(r293) I. Show Description
Heterozygotes are WT and segregate WT, Unc, and early larval lethal.
|
|
| DR293 |
C. elegans |
dpy-5(e61) unc-101(m1) I. Show Description
Dpy. Unc-paralyzed coiler.
|
|
| EU780 |
C. elegans |
spd-2(or293) I; him-8(e1489) IV. Show Description
Him. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
|
|
| PD8117 |
C. elegans |
smg-1(cc545) unc-54(r293) I. Show Description
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]
|
|
| PD8118 |
C. elegans |
smg-1(cc546) unc-54(r293) I. Show Description
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| TR1324 |
C. elegans |
smg-5(r860) unc-54(r293) I. Show Description
P-Vul.
|
|
| TR1417 |
C. elegans |
smg-1(r904) unc-54(r293) I. Show Description
P-vul.
|
|
| TR1421 |
C. elegans |
smg-2(r908) unc-54(r293) I. Show Description
P-Vul.
|
|
| TR1696 |
C. elegans |
unc-54(r293) I; smg-3(r930) IV. Show Description
P-vul.
|
|
| TR2192 |
C. elegans |
unc-54(r293) I; smg-4(r1169) V. Show Description
P-vul. WT movement.
|
|
| TR2230 |
C. elegans |
unc-54(r293) I; smg-7(r1197) IV. Show Description
P-Vul. WT movement.
|
|
| TR2264 |
C. elegans |
unc-54(r293) I; smg-6(r1217) III. Show Description
P-Vul. WT movement.
|
|