| RB594 |
C. elegans |
glc-3(ok321) V. Show Description
ZC317.3. Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Primer PCR Length: 2747 bp. Deletion Size: 1258 bp. Deletion left flank: GCGATTTTTGTGCTTGGCGTCAAAAATGAT. Deletion right flank: AAATGCATCGGACATGACAAAACCATCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| XA7400 |
C. elegans |
glc-3(ok321) V. Show Description
ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
|
|
| MQD2884 |
C. elegans |
vit-2(ok3211) vit-1(hq532) X. Show Description
hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https://doi.org/10.1101/2022.06.27.497668
|
|
| RB2364 |
C. elegans |
D2023.6(ok3210) V. Show Description
D2023.6 Homozygous. Outer Left Sequence: tgtcaacggaggtgttttca. Outer Right Sequence: actatctgaacggcgaatgg. Inner Left Sequence: aacacatttcgggaatggaa. Inner Right Sequence: aaaaacggcagaaagaccaa. Inner Primer PCR Length: 1204. Deletion size: about 700bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2365 |
C. elegans |
vit-2(ok3211) X. Show Description
C42D8.2 Homozygous. Outer Left Sequence: atggagcacgctcttgctat. Outer Right Sequence: tgggatctttccagagatgg. Inner Left Sequence: tcacatggaaaacgaggaca. Inner Right Sequence: gctcttggttgagaagacgg. Inner Primer PCR Length: 1222. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2366 |
C. elegans |
T12B3.4(ok3212) IV. Show Description
T12B3.4 Homozygous. Outer Left Sequence: gatggctccagaagacgttc. Outer Right Sequence: cactgaaaaatgtgcgtggt. Inner Left Sequence: tttttgttgggtccttcttttt. Inner Right Sequence: tgatatcttggcatttggga. Inner Primer PCR Length: 1166. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2367 |
C. elegans |
srh-49(ok3217) I. Show Description
C10G11.4 Homozygous. Outer Left Sequence: caatgtccttcccaacatca. Outer Right Sequence: ttaatttttgaattcgcccg. Inner Left Sequence: caagattattatgctacaaactacacg. Inner Right Sequence: gttccagcatctctcctcgt. Inner Primer PCR Length: 1357. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2368 |
C. elegans |
R03G8.6(ok3218) X. Show Description
R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2369 |
C. elegans |
haf-6(ok3219) I. Show Description
Y48G8AL.11 Homozygous. Outer Left Sequence: tttgacaccacacggaaaaa. Outer Right Sequence: tcacgttaagtattcccggc. Inner Left Sequence: aaaaacctcggccaccac. Inner Right Sequence: ttcgtgtcgagaccgaacta. Inner Primer PCR Length: 1195. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2495 |
C. elegans |
sur-6(ok3215) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26E4.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3215 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAGCCGATGTGATCTCTTG. External right primer: TGTTCAAATCCCACACCTGA. Internal left primer: GAATATTTGGCAACGGGAGA. Internal right primer: CCTTGACAGTAAGATAGTCCCTCG. Internal WT amplicon: 1263 bp. Deletion size: 438 bp. Deletion left flank: AATCAAGTATAACATTAATGATTAAATATT. Deletion right flank: GTTAACCTTTGGAATCTGGAGATTACCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2523 |
C. elegans |
med-1(ok3216) X. Show Description
T24D3.1. External left primer: CGCGTAAAATCCATGTTGTG. External right primer: TCTAGTGGGTGACAATCGCA. Internal left primer: CGTCCGAAGGCAAATAAAAG. Internal right primer: ATTTCGGCCCTTTTTGTCTC. Internal WT amplicon: 1163 bp. Deletion size: 630 bp. Deletion left flank: TTGAATCAGTTTTCATACTTTATTCCTTCT. Deletion right flank: ACATTTATATTTAATTCTTGTTCTCGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2547 |
C. elegans |
+/szT1 [lon-2(e678)] I; ced-8(ok3213)/szT1 X. Show Description
F08F1.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3213 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAATATCAGCACCAATGCG. External right primer: TGCAATGTGCTCCTATGCTC. Internal left primer: CTTACCTGCAAAACCGCTTC. Internal right primer: CAATCTTTCATTTTTGGGCG. Internal WT amplicon: 1179 bp. Deletion size: 649 bp. Deletion left flank: CTTTCTCAATCTTACCTGCAAAACCGCTTC. Deletion right flank: GTGACCGCAAACTGATTAGTCTCTTGAAAT. Insertion Sequence: ACCGCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|