Search Strains

uaEx25 [(p016bA352V) nuo-1(+) + unc-119(+)]. Contains extrachromosomal nuo-1(A352V) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of the transgene. Low brood size. Short life span. Sensitive to oxidative stress.

uaIs26 [(p016bT434M) nuo-1(+) + unc-119(+)]. Carries integration of nuo-1(T434M) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Site of integration unknown. Moderate brood size. Shorter life span. Sensitive to oxidative stress.

uaEx27 [(p016bA443F) nuo-1(+) + unc-119(+)]. Contains an extrachromosomal array carrying nuo-1(A443F) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Low brood size. Short life span. Sensitive to oxidative stress.

Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.

Heterozygotes are WT and segregate WT (fluorescent), Dpys (highly fluorescent) and L3 lethals (non-fluorescent). GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence. Called LB21B.

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.

mKate2 tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.

mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus.

mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. Unc-6 netrin mutation causes reduced movement and protruding vulva (Pvl) phenotype.

qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.