Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MT13954 C. elegans mir-81&mir-82(nDf54) X. Show Description
Deletion breakpoints are: AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
ENL54 C. elegans daf-2(e1370) III; mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
ENL55 C. elegans daf-2(e1370) mir-80(nDf53) III; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
ENL20 C. elegans mir-80(nDf53) III; daf-1(m213) mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
ENL21 C. elegans daf-2(e1370) mir-80(nDf53) III; mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive (daf-c).
CGC179 C. elegans mir-82(umn86[mir-82p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
CGC180 C. elegans mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
DPB2313 C. elegans mir-43(sjm3) II. Show Description
Homozygotes lack gross phenotypes. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between miR-42* and miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
DPB2316 C. elegans mir-43(sjm3) II; ebax-1(tm2321) IV. Show Description
Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between mir-42* and mir-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm3) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
MCJ191 C elegans mir-35(cdb2 cdb78) II. Show Description
cdb2 cdb78 is a mutation to the 3' end of the mature mir-35 creating a mutant with mir-35 seed sequence and mir-82 3’ end. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MT14128 C. elegans nDf53 III; nDf54 X. Show Description
Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73.
MT15563 C. elegans nDf53 III; mir-58.1(n4640) IV; nDf54 X. Show Description
Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1842 C. elegans unc-119(ed3) III; maIs300. Show Description
maIs300 [mir-82p::GFP + unc-119(+)]. Wild type.