| BOX188 |
C. elegans |
maph-1.1(mib12[GFP::maph-1.1]) I. Show Description
Endogenous maph-1.1 locus tagged with GFP using CRISPR/Cas9. Animals are homozygous viable and express GFP::maph-1.1 ubiquitously. Reference: Waaijers S, et al. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. PMID: 27506200
|
|
| RG3527 |
C. elegans |
maph-1.2(ve1027[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 4123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAATAAATTTACTCGGGGGGAAAAATAA ; Right flanking sequence: TGGAAGCTAGTATTTCTGGTTATTTTTAGA. maph-1.2 crRNA A: TAAATAAGTTATGCgggggg; maph-1.2 crRNA B: AATCAATACGCCACTTCTAT. [NOTE: maph-1.2 shares sequence identity with other loci on LGIII and LGIV. Classical genetic mapping was performed confirm the location of the INDEL in LGI.] Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| STR318 |
C. elegans |
unc-119(ed3) III; hrtSi28 IV. Show Description
hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
|
|
| VC4473 |
C. elegans |
maph-1.3(gk5546[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4864 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAGTTGAAAATGAAAAAAATCCACCCATC. Right flanking sequence: ATGGGGTGTGCCCGACAAAAATGGGGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4576 |
C. elegans |
maph-1.1(gk5647[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4814 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTTATTCATTTTGATATGTGTCTCTAGGCA. Right flanking sequence: GAATGCTCTTCAAAATCACTATTTTTAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|