| VC2754 |
C. elegans |
hsp-60(ok3508)/sC1 [dpy-1(s2170)] III. Show Description
Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VH7154 |
C. elegans |
hsp-60 (hd7146 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|