| PS2767 |
C. elegans |
hmg-1.2(sy549) III; dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2943 |
C. elegans |
hmg-1.2(sy549) unc-32(e189) III; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Unc. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS3170 |
C. elegans |
dpy-17(e164) hmg-1.2(sy549) III; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Dpy. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| RW10850 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10776. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10776 [hmg-1.2::H1-wCherry + unc-119(+)].
|
|
| RW12210 |
C. elegans |
hmg-1.2(st12210[hmg-1.2::TY1::EGFP::3xFLAG]) III. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| RW12311 |
C. elegans |
hmg-1.1(st12311[TY1::EGFP::3xFLAG::hmg-1.1]) II. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| VC1421 |
C. elegans |
hmg-1.2(ok1906) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F47D12.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1906 homozygotes (Dpy, larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGACTCGCAACCCTCTTCT. External right primer: ATTGTCAACAGAGAACCGGC. Internal left primer: CTATTCGCGTGATCTTGTGC. Internal right primer: ACTTTGGGCTCTTCTGGTGA. Internal WT amplicon: 2101 bp. Deletion size: 759 bp. Deletion left flank: ATTCTGGTTACAGCGCAAACATTTTTCCCA. Deletion right flank: AAAAGAGCCCTGTAAGTTTTTTAAAGTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1238 |
C. elegans |
hmg-11(ok1303) II. Show Description
T05A7.4 Homozygous. Outer Left Sequence: ctcgtggaagccctagacag. Outer Right Sequence: catcgggaaagtacggaaga. Inner Left Sequence: tcagatggtatgatcgccaa. Inner Right Sequence: tcagactgtcacatcgctcc. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG3372 |
C. elegans |
hmg-11(ve872[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 452 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCAGAATGAGTGGAGAAGTTGGATCCA ; Right flanking sequence: ACTGGAGAGAAGAAGGGACGTGGACGCCCA. hmg-11 sgRNA #1: ACGAATGCCTTGTTTCTACC; hmg-11 sgRNA #2: CAAAGCAGCAAGAGCCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RW11085 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10934. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10934 [hmg-11::H1-wCherry + unc-119(+)].
|
|
| TH184 |
C. elegans |
unc-119(ed3) III; ddIs101. Show Description
ddIs101 [hmg-11::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|