Search Strains

More Fields
Strain Species Genotype Add
VH7201 C. elegans eif-2gamma(hd7196[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7196 and CGC92. hd7196 is a 1856 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TACGCTAATGCAAAGATCTACAGATGTTCT; Right flanking sequence: AGGAAGAGTTACTGCTGTGAAGGGAGACGC. sgRNA #1: AACCAAGAGTGCCCAAGGCC; sgRNA #2: ATTGGATCGTTGTCAACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.