Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VH7165 C. elegans ps-25&sf1=all">mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54UTR + ps-2&sf1=all">rps-2 7p::neoR::unc-54UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.