Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1292 C. elegans fbxa-137&nhr-228(gk581) V. Show Description
T27B7.6, T27B7.7. External left primer: CTCCCAACAACTGCCACTTT. External right primer: CATCAACCACTTTGTCACCG. Internal left primer: GCGATGGACCTGAGAGAGAA. Internal right primer: GCTTAAAGCCTTGCGTCAAC. Internal WT amplicon: 2002 bp. Deletion size: 1353 bp. Deletion left flank: CTTGGCTGTTGGTCAAATTTGAGGAGTACT. Deletion right flank: ACTTAAAAAATTACTATAAAAATGAGGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG5043 C. elegans kars-1(gk5813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5813 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4745 and CGC66. gk5813 is a 2292 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG; Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4742 C. elegans Y62E10A.19(gk5810[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4057 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAAGCGGCAGAGAAATGACTGTTGGTTT. Right flanking sequence: AGGTTACACCTCCATATTCAAGATTCGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4743 C. elegans mdt-9(gk5811[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTGAATATCTCGACGAAGAACGTGATCTT. Right flanking sequence: TGGAATGAAAAAGTGTGTCCGTGTATTATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4744 C. elegans myo-1(gk5812[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7506 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAGATGATGGACAGGAGGAAGAAAATCGA. Right flanking sequence: GGGACGGATAATAGTTTGGCACACACAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4745 C. elegans kars-1(gk5813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5043 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2292 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG. Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4746 C. elegans trcs-2(gk5814[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGCACTCGATAGTCGAATGATGTCGAAGA. Right flanking sequence: CGGATAGATTTCCGACATCTATCATTTTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4747 C. elegans cytb-5.2(gk5815[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 520 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAACGACTTAGAGACCATTTTTTGTT. Right flanking sequence: TGATCTTATGCGCCCACTTTCTTGAAATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4748 C. elegans ads-1(gk5816[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2646 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GCCTTCAACAACGCAATTCCGACTGCTCCG. Right flanking sequence: AGGTTACCGATAAGATTGCGGCACGTCGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4749 C. elegans pigb-1(gk5817[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAGGAGATTAATAAGAAATAATAGGACCT. Right flanking sequence: TGGTAGCCACTGATTTGCTGCTTCCAGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4750 C. elegans dpm-1(gk5818[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2579 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTTTCACATGAAGTGATTATCGTTGACGAT. Right flanking sequence: GTTTCCAAACATTCTTGTTTAAATTATATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4751 C. elegans mdt-17(gk5819[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 14905 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TATTGTTACGTGACATTGTTGAGACCATTG. Right flanking sequence: CGGCTCGATAGGCTCCACCACTTCATCGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.