| VC1320 |
C. elegans |
nhr-123(gk577) V. Show Description
M02H5.7. Superficially wild type. External left primer: CTGCGAAGAGGTGTGAGACA. External right primer: TGATGGAAGCATAATTGGCA. Internal left primer: ATTCGAAATCGGAGAGCAGA. Internal right primer: ATTGGTCGAAACTGGAATGC. Internal WT amplicon: 2189 bp. Deletion size: 427 bp. Deletion left flank: GGTATTTCAAAAAAATTCAAGCCTTGCAAA. Deletion right flank: CAAGTTCCCAATGTGTTGCAAAAATTAGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG5030 |
C. elegans |
gfi-2(gk5771[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5771 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4702 and CGC92. gk5771 is a 2938 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAAACTTCATCAATATCAATGAATCTGC; Right flanking sequence: TCACTCCTGGGTACTGAGTACCTTGACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4701 |
C. elegans |
snr-6(gk5770[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGTGGATGAGAGTGATGTTGTCTCCTTTG. Right flanking sequence: GGCGGAATTTTGAATTTAATAAAATGCAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4702 |
C. elegans |
gfi-2(gk5771[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5030 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2938 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGAAACTTCATCAATATCAATGAATCTGC. Right flanking sequence: TCACTCCTGGGTACTGAGTACCTTGACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4703 |
C. elegans |
Y111B2A.2(gk5772[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CACTGGCTGTCGCTGTCGTCTCGACTGCCG. Right flanking sequence: AGGAATTGGCGAAATTGTACGAGGAGAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4704 |
C. elegans |
T22D1.5(gk5773[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1504 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATGAGCCAGCAGATTCAGATGAAGTCTGT. Right flanking sequence: GGCGGATTCATGTAAACAATAAGATTGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4705 |
C. elegans |
arrd-16(gk5774[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3818 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAATTTTACGAATTTTTGAAAAATGCCA. Right flanking sequence: GGGCAGGCAGGCAGGTAGGTAGGGATAGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4706 |
C. elegans |
D2030.4(gk5775[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 759 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCATATTCACATTTATCCCAAGCTCCACGT. Right flanking sequence: GCGGGTTCATTGACCGAATTTTCAATGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4707 |
C. elegans |
rps-5(gk5776[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 882 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGAAAACAAATAGTATGAACAAACAATAC. Right flanking sequence: ATAACAACTTCAGTATAGTTTAAAAAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4708 |
C. elegans |
ZK287.1(gk5777[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 3083 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGGCGACGCCGGCGGCGGTGCGCAGAAG. Right flanking sequence: ATTTTTTTTATTTATGTACCATTTGTAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4709 |
C. elegans |
vps-24(gk5778[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1298 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CACGTTGTCATCGTTTCGCAATATTTGTTG. Right flanking sequence: CATCTTACTGTAATATACGGAACCCTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4710 |
C. elegans |
tpst-1(gk5779[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 9239 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATACTCTCAAAATAATCGAGATTGCAGAA. Right flanking sequence: GTGGGAAAAACAAGGAGCAATTTCTATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|