Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1168 C. elegans bbs-2(gk544) IV. Show Description
F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTTCAAAAAGTCCCTCTGCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: TTATGTGAGGCTTCGACACG. Internal WT amplicon: 1741 bp. Deletion size: 712 bp. Deletion left flank: GATAATGTCGAACTTGCAAATGTATTTTCG. Deletion right flank: TTAAAAGAAAGACAATGGAGAATCAAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4357 C. elegans ZK185.3(gk5440[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2074 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTTTCTCCGTGTACCTCTTTGTACCAATG; Right flanking sequence: GGCGGCTGAATGCGATCTTTTCCAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4360 C. elegans Y48E1C.2(gk5443[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 4099 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTAAATTTTCAGATGGAAGAGCAGGAGCC; Right flanking sequence: GCCATCTACTCGACCCTCGAACCCGGCGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4361 C. elegans sucg-1(gk5444[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGATTTTTAAGATTAATAATGCTTCGTGCT. Right flanking sequence: GGAGGTGAACCAGCAAACTTCCTCGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4364 C. elegans srr-7(gk5446[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2103 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTATGTATGAGCTCTTTTGGAATAGACAC. Right flanking sequence: CGCGGTTTTTTTTTCAAATTTGTATTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4366 C. elegans srg-1(gk5448[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1163 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAATTTTTTGATTTTGAGTTGCCGAAGTAA; Right flanking sequence: CGGCATTCGGTATTCAGCTTCAATTTTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.