| VC4366 |
C. elegans |
srg-1(gk5448[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1163 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAATTTTTTGATTTTGAGTTGCCGAAGTAA; Right flanking sequence: CGGCATTCGGTATTCAGCTTCAATTTTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CHS1115 |
C. elegans |
srg-1(yum1684) srg-11(yum1679) III; srg-14(yum1680) I; srg-15(yum1681) srg-16(yum1682) srg-17(yum1683) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1192 |
C. elegans |
srg-10(yum2151) srg-13(yum2152) srg-20(yum2153) srg-21(yum2154) srg-22(yum2155) srg-23(yum2156) srg-24(yum2157) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| OH14099 |
C. elegans |
him-5(e1490) V; otIs630 X. Show Description
otIs630 [srg-13::BirA::nrx-1 + inx-18p::AP::nlg-1 + unc-122::streptavidin::2xsfGFP + inx-18p::wCherry + rol-6(su1006)] X. Rollers. Trans-synaptic labeling of PHA to AVG synapses (iBLINC). AVG process is labeled with mCherry. Reference: Oren-Suissa M, et al. Nature. 2016; 533:206-211. PMID: 27144354
|
|
| OH14240 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6616. Show Description
otEx6616 [srg-14p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH16065 |
C. elegans |
otIs355 IV; otIs747. Show Description
otIs355 [rab-3p::2xNLS::TagRFP] IV. otIs747 [srg-13p::GFP]. PHA neurons are labeled with GFP and RFP. Can be used to isolate PHA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| PS8849 |
C. elegans |
syIs710; syIs300. Show Description
syIs710 [srg-13p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|