Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1172 C. elegans nhr-129&nhr-168(gk538) V. Show Description
C50B6.14, C50B6.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4297 C. elegans Y71H2B.2(gk5380[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2972 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AACAATCGAGAAATGCTAATCAAAAGAAAA. Right flanking sequence: TGGCAAACGAAGAGCAGCTCGCCACCGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4299 C. elegans srh-216(gk5382[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2643 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATTCCCAAATTGTTCCTCCCAAAACCTCCC; Right flanking sequence: TGGGGTCGTGAAGAAGCTAAGTGATAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4300 C. elegans rig-5(gk5383[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 8834 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGGCTGAATCCACTTGAATTGCTCGGAGC; Right flanking sequence: GTAATAGCGACGATTGAGCAATGAAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4301 C. elegans rpb-7(gk5384[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1546 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGCGAATCGTTGAAAACCAGATCATTCCG. Right flanking sequence: GCGTGCCAACGAGACGAAGAATGCGCCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4302 C. elegans mcm-3AP(gk5385[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
F20D12.2. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4523 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCGCTCGCCAGCCGTCTCACGGTTCCTTCA. Right flanking sequence: CGATGATAATCTTTCCGATTTACTGTATTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4303 C. elegans clr-1(gk5386[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 6585 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCGGTGAGTTTTTTTAAAAGAAGGACTAAC. Right flanking sequence: ATGTTTACCCGTTTTGAGCAGTATTCTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4305 C. elegans ints-4(gk5388[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 9499 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGAGCGAAGTTTTCGAAGAAGGAATCTACA. Right flanking sequence: CTCGGCCGTTGAAAATGTGCTCAAATTCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.