Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
VC4299 C. elegans srh-216(gk5382[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2643 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATTCCCAAATTGTTCCTCCCAAAACCTCCC; Right flanking sequence: TGGGGTCGTGAAGAAGCTAAGTGATAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1033 C. elegans srh-127(yum1249) srh-211(yum1250) srh-212(yum1255) srh-213(yum1256) srh-214(yum1251) srh-215(yum1252) srh-216(yum1253) srh-217(yum1254) srh-218(yum1257) srh-219(yum1258) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.