Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1159 C. elegans Y75B8A.29(gk535) III. Show Description
Y75B8A.29. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4267 C. elegans M153.4(gk5350[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCTAGCAACAAACAATCATGTGCTCCTCCT; Right flanking sequence: GTGGGAAGGAGTAGATCAAAAAGTCAATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4270 C. elegans lron-7(gk5353[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1555 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCATTGTGATGTACACGAAATCGACTGTAG; Right flanking sequence: ACTGGTTGGCTTCATTGCAATCGGAACTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4273 C. elegans F59E12.1(gk5356[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1652 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACTCTTGTTCTTCCTCCAACCAAGCCTCCC; Right flanking sequence: TTGGGTGAAGCAACATACGATCAAGGAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4275 C. elegans srz-4(gk5358[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1680 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTAGATATACCGCATGTTTGAACTCCTACT; Right flanking sequence: CGAAACCAGGTGCCTATATAATTCCAGTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4276 C. elegans F46B3.7(gk5359[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 319 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATCCAGTATCAAATTGAGGTTTGGTTCCA; Right flanking sequence: CTTGGGTTGGAATACAGGCAACAATAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.