Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC889 C. elegans wwp-1(gk372) I. Show Description
Y65B4BR.4a. gk372 is a 1509 bp deletion with a 146 bp insertion. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3763 C. elegans EEED8.12(gk3721[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 264 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTGTAGAGTTAAAATCTACATTTCCA; Right flanking sequence: CAGAAGGGAAACCATAAATAACGATGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3764 C. elegans rsp-4(gk3722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 404 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCGTTTCTGTTAGCTATATTCAATTC; Right flanking sequence: TGGTGGTGGACGTAGAAGGTTAGTATACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3766 C. elegans kin-24(gk3724[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 978 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACATCACCGACTCGCGTGCAAAATCCG; Right flanking sequence: GGTTCCAGCAATGCAGGCTGTTCTCAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3769 C. elegans lgc-31(gk3727[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATGATTATCTGGATCCACCGTTATTTTGGG; Right flanking sequence: AGGTGAGTCGGGTGGAACCTCGAACACGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3771 C. elegans lgc-15(gk3728[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 877 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACAACTGTAACTCTGAAACTATTGAAGC. Right flanking sequence: TGGACACGATCCAGACGCCCCGGGACGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.