Search Strains

More Fields
Strain Species Genotype Add
CA1207 C. elegans dhc-1(ie28[dhc-1::AID*::GFP]) I. Show Description
An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be combined with different TIR1 strains to examine spatial and temporal requirements for dynein, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1210 C. elegans dhc-1(ie28[dhc-1::AID*::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in somatic tissue, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1212 C. elegans dhc-1(ie28[dhc-1::AID*::GFP]) I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in pharyngeal muscle, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1213 C. elegans dhc-1(ie28[dhc-1::AID*::GFP]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used to examine spatial and temporal requirements for dynein in the intestine, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1215 C. elegans dhc-1(ie28[dhc-1::AID*::GFP]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in the germ line and early embryos, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
KAE28 C. elegans unc-119(ed3) III; seaEx13. Show Description
seaEx13 [fmo-2p::GFP + unc-119(+)]. Pick non-Unc to maintain. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
SV314 C. elegans rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.
CB286 C. elegans unc-45(e286) III. Show Description
Slow moving Unc. Body muscle abnormal. Temperature sensitive. Recessive. M-MATING+POOR <1%WT.
CB5664 C. elegans dpy-31(e2770) III; sqt-3(e2809) V. Show Description
Dumpy (partially-suppressed Dpy-31). Sqt-3 mediated suppression of dpy-31 lethality. Reference: Novelli et al. (2004) PMID: 15579684.
CB5680 C. elegans bus-16(e2802) I. Show Description
Resistant to infection by Microbacterium nematophilum (no tail swelling). Skiddy movement; frequent vulval rupture; bleach sensitive; hypersensitive to drugs. Abnormal lectin staining.
CB6036 C. elegans him-17(e2806) V. Show Description
Him. Sterile at 25C. Weak allele, M223I.
CB6038 C. elegans tax-4(e2861) III. Show Description
Chemotaxis-defective; partly resistant to bacterial infection by Microbacterium nematophilum (Bus phenotype) and Leucobacter Verde2; abnormal surface. Reference: Yook & Hodgkin (2007) PMID: 17151260.
CB6081 C. elegans bus-17(e2800) X. Show Description
Resistant to infection by Microbacterium nematophilum (no tail swelling). Skiddy movement; bleach sensitive; hypersensitive to drugs. Abnormal lectin staining.
CB6147 C. elegans bus-8B(e2882) X. Show Description
Viable allele. Hypersensitive to many drugs.
CB6177 C. elegans bus-8B(e2883) X. Show Description
Viable slightly dumpy hermaphrodites, drug and bleach sensitive, resistant to M. nematophilum (Bus phenotype) and Leucobacter Verde1, hypersensitive to Leucobacter Verde1. References: Partridge et al. (2008) PMID: 18395708. Hodgkin et al. (unpublished, in preparation).
CB6193 C. elegans bus-8B(e2885) X. Show Description
Viable allele. Hypersensitive to many drugs.
CB6208 C. elegans bus-8B(e2887) X. Show Description
Cold-sensitive lethal allele. Viable at >18C. Strongly hypersensitive to many drugs.
CB6216 C. elegans bus-8B(e2887) X; eEx541. Show Description
eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. Nearly inviable, severely dumpy bus-8 mutant rescued by array. Reference: Partridge et al. (2008) PMID: 18395708.
CB6233 C. elegans dpy-17(e2898) dpy-31(e2770) III. Show Description
Viable dumpy. Suppressor allele of dpy-17: lethality of dpy-31(e2770) suppressed by e2898. Reference: Novelli et al. (2006) PMID: 16452136.
CB6234 C. elegans dpy-17(e2899) dpy-31(e2770) III. Show Description
Weak dumpy. Lethal dpy-31 mutation suppressed by dpy-17 mutation. Reference: Novelli et al. (2006) PMID: 16452136.
CB6253 C. elegans bus-8B(e2992) X; eEx541. Show Description
eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(e2892) animals are viable on Leucobacter Verde1, unlike most other bus-8 mutants. References: Partridge et al. (2008) PMID: 18395708. Stroud et al (in preparation).
CB7181 C. elegans bus-8B(e2883e3071) X. Show Description
Weak Bus, viable on Leucobacter Verde1. e3071 is a missense intragenic revertant (P97S) of e2883 (G378E). Reference: Stroud et al (in preparation).
DR1228 C. elegans unc-45(e286) daf-7(e1372) dpy-1(e1) III. Show Description
Dpy. Temperature sensitive dauer constitutive (leaky). Temperature sensitive Unc. At 15C, Dpy adults and some dauers. At 25C, DpyUnc dauers and some DpyUnc adults (leakiness varies: 60-95% dauers).
DV3670 C. elegans rheb-1(re64 re285[AID*::mKate2::3xFlag::rheb-1]) III. Show Description
AID* tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous mKate2 expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. universal mKate2 site crRNA: catgttttctttaatgagct / insertion site in mKate2:gaagATGCCA....GGAGCATCGGGAGCCTCAGGAGCATCGATGGTCTCCGAGC^TCATTAAAGA. Reference: Fakieh R, et al. MicroPubl Biol. 2022 Aug 9:2022:10.17912/micropub.biology.000622. doi: 10.17912/micropub.biology.000622. PMID: 36035777.
GE2827 C. elegans xpf-1(e1487) II; unc-24(e138) T22B11.1(t1786)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2886 C. elegans xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V. Show Description
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
GE2895 C. elegans xpf-1(e1487) II; unc-24(e138) T22B11.1(t1866)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. Show Description
Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1866 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2895 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.
LV13 C. elegans unc-45(wc4)/unc-45(e286) III. Show Description
Maintain this strain at 15C so that you can score for dead eggs (3 fold stage). At 15C, both hets and e286 homozygotes move reasonably well. Place single animals on plates and allow them to lay eggs for a day; then remove the parent and score the plates the next day for dead eggs. At 25C, both hets and e286 homozygotes will be Unc and Egl; dead eggs will remain inside the parent worm.
RW1329 C. elegans pat-12(st430)/unc-45(e286) III. Show Description
At 20C heterozygotes are WT and segregate WT, Uncs and PATs. st430 is a recessive lethal causing "mild" PAT phenotype. unc-45 is temperature sensitive (WT at 15C).
RW3550 C. elegans pat-4(st551)/unc-45(e286) III. Show Description
Heterozygotes are WT and segregate WT, Uncs (at 20C and 25C) and Pats. Maintain by picking WT at or above 20C. See also WBPaper00005261.
SP529 C. elegans unc-45(e286) dpy-1(e1) III. Show Description
Dpy. Unc (ts).
SV1930 C. elegans swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
UP725 C. elegans mat-3(cs53)/unc-45(e286) III. Show Description
Heterozygotes are WT and segregate WT, Uncs, and Pvul which are sterile.
XE2835 C. elegans wpIs39 X; otIs92. Show Description
wpIs39 [unc-47p:mCherry] X. otIs92 [flp-10::GFP]. DVB neurons are marked with GFP and mCherry. Can be used to isolate DVB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XE2839 C. elegans mtx-2(wy50266) III; miro-1(wy50180) IV; oyIs14 V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.