| pigq-1(ve1034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTTTAATTTTCACGAAAAGATGTTATT ; Right flanking sequence: TGGACTGTATTAATTGAACTACCCAATTGA. pigq-1 crRNA A: TTTCAATCAAGCTTCCCATT; pigq-1 crRNA B: AACGGTAAAACGAGCGAGGG. Note:The crRNA B target is in the predicted 3' UTR of an allele of F01G4.6. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
