| CB7431 |
C. elegans |
bus-17(br2) X. Show Description
Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Reference: Yook K, Hodgkin J. Genetics. 2007 Feb;175(2):681-97.
|
|
| MSB1041 |
C. elegans |
bus-17(br2) X; mirIs92. Show Description
mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
|
|
| MSB577 |
C. elegans |
bus-17(br2) X; mirEx123. Show Description
mirEx123 [myo-3p::TeNL::unc-54 3' UTR]. Maintain strain by picking animals with blue fluorescence. bus-17(br2) has mutant defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in muscles. Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
|
|
| ABR212 |
C. elegans |
acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
|
|
| ABR225 |
C. elegans |
acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
|
|
| BR2742 |
C. elegans |
pept-1(lg601) X. Show Description
Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45.
|
|
| BR2815 |
C. elegans |
nep-1(by159) II. Show Description
1450 bp deletion. Deletion removes 245 bp of promoter, 1st exon and 2nd exon.
|
|
| BR2823 |
C. elegans |
chn-1(by155) I. Show Description
989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.
|
|
| BR2958 |
C. elegans |
ceh-16(lg16) III; jcIs1 IV; ngEx1. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.
|
|
| HBR2025 |
C. elegans |
unc-119(ed3) III; goeEx711. Show Description
goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms.
|
|
| HBR205 |
C. elegans |
goeIs22. Show Description
goeIs22 [mec-4p::SL1::GCaMP3.35::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several mechanosensitive neurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
|
|
| HBR2256 |
C. elegans |
goeEx737. Show Description
goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Current Biology (accepted).
|
|
| HBR227 |
C. elegans |
aptf-1(gk794) II. Show Description
Complete lack of behavioral quiescence during sleep. References: Turek et al. Current Biology, 2013, 23, 2215-2223. Turek et al. eLife 2016;5:e12499.
|
|
| HBR2317 |
C. elegans |
nlp-8(syb762) IV. Show Description
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR232 |
C. elegans |
aptf-1(tm3287) II. Show Description
Complete lack of behavioral quiescence during sleep. Reference: Turek et al. Current Biology, 2013, 23, 2215-2223.
|
|
| HBR2340 |
C elegans |
flp-11(syb1445[flp-11::SL2::unc-58(L428F)::linker::mKate2]) X. Show Description
unc-58(L428F) was knocked into the endogenous locus of flp-11 to express a sodium channel in RIS that causes strong overactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|