Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JN1713 C. elegans peIs1713. Show Description
peIs1713 [sra-6p::mCasp-1 + unc-122p::mCherry]. ASH neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.
JN1715 C. elegans peIs1715. Show Description
peIs1715 [str-1p::mCasp-1 + unc-122p::GFP]. AWB neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.
PHX11029 C. elegans asp-1(syb11029[myo-2p::mCherry::unc-54 3'UTR]) V. Show Description
syb11029 is a replacement of the asp-1 locus, removing the entire coding sequence and inserting the myo-2p::mCherry reporter. Upstream flanking sequence: tccttcttccaggta. Downstream flanking sequence: gtaggaatggtgtttt. Guide sequences: Sg1:ccaggtaATGCAGACCTTCGTTT Sg2:TTCGCCACCGCCGTCCACAAGGG.
VC3724 C. elegans tasp-1(gk3684[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 57 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCCTTCTGAAACATCGATTCAGTGGAG. Right flanking sequence: AGGTTTGCGCACACTAATTATCGATTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
DMS107 C. elegans dmaIs10. Show Description
dmaIs10 [asp-17p::GFP + unc-54p::mCherry]. Reference: Jiang W, et al. Elife. 2018 Apr 17:7:e35037. doi: 10.7554/eLife.35037. PMID: 29664006
PS9705 C. elegans asp-12(sy1899) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
RG3314 C. elegans asp-19(ve814[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAAAACCTAGACCAACAATGGTTGCAATT ; Right flanking sequence: AGTGCATCTCATGAAAAAAATAGAGACGGG. sgRNA #1: ACCATTACAAAGCAAGAGCT; sgRNA #2: TGCTGTTTTGTAGCTCACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.