Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BC11393 C. elegans dpy-5(e907) I; sEx11393. Show Description
sEx11393 [rCes F26H9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14539 C. elegans dpy-5(e907) I; sEx14539. Show Description
sEx14539 [rCes F26H9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
RB1183 C. elegans prom-1(ok1140) I. Show Description
F26H9.1 Homozygous. Outer Left Sequence: gatcgaagccaaagaacgaa. Outer Right Sequence: tgaggggacattcacacgta. Inner Left Sequence: tgggtactgtagtgggggtg. Inner Right Sequence: aaaggaggaacaaaatgggg. Inner Primer PCR Length: 2240. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1738 C. elegans F26H9(ok2199) I. Show Description
F26H9. External left primer: ACAAAAGGACGCATCAAACC. External right primer: TTCATACGGGTGTCTCACGA. Internal left primer: TGGGGGTACTGTGGGATTAC. Internal right primer: CAAAAATGGATGAAAACGGG. Internal WT amplicon: 2181 bp. Deletion size: 582 bp. Deletion left flank: GAGAGTGATCAGAAACGAAAAATTTTTTTT. Deletion right flank: GCGCGTTTTTTTTAAATTTAGCCAAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1961 C. elegans F26H9.8(ok2510) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2199 C. elegans rab-5(ok2605) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2605 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTGCTGAAAACCGTCACAA. External right primer: GCTCATTCACTGGCTGAACA. Internal left primer: TTGCGTTGATTTCGAAGTTT. Internal right primer: TTCGAGGGGAAAACAATGAC. Internal WT amplicon: 1186 bp. Deletion size: 359 bp. Deletion left flank: GAAAGACGTAAAAACGTTAATAATTAAGAA. Deletion right flank: ATAAAAACATGTTAACAGAGTACTGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7081 C. elegans F26H9.5(hd7081[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.