Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC3977 C. elegans C48B6.3(gk5054[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 801 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGAGCTGTTCTTCGAGAACTGGCGGTGCCC; Right flanking sequence: AAATAACTCAACGACATCTCCAACGTCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
JTL720 C elegans haps-1(ljt1) I. Show Description
CRISPR-engineered KO strain of haps-1 made by knock-in of tandem stop codons to the first exon of endogenous haps-1 locus. haps-1(C48B6.3) is the C. elegans ortholog of human HAPSTR1. haps-1(ljt1) is superficially wild-type when cultured at 20C, but is hypersensitive to paraquat (redox stress), MLN4924 (neddylation inhibition), and camptothecin (genotoxic stress). Reference: Amici DR, et al. Proc Natl Acad Sci U S A. 2022 Jul 5;119(27):e2111262119. doi: 10.1073/pnas.2111262119. PMID: 35776542.