| NC571 |
C. elegans |
dpy-20 (e1282) IV; wdIs20. Show Description
wdIs20 [unc-4p::snb-1::GFP + dpy-20(+)]. Animals are Lon, likely due to dpy-20(+) overexpression. Punctate GFP expression observed in dorsal nerve cord, ventral nerve cord, VC4, and VC5. Reference: Lickteig KM, et al. J Neurosci. 2001 Mar 15;21(6):2001-14.
|
|
| NH2466 |
C. elegans |
ayIs4 I; dpy-20(e1282) IV. Show Description
ayIs4 [egl-17p::GFP + dpy-20(+)] IV.
|
|
| NL1140 |
C. elegans |
dpy-20(e1282) IV; pkIs379. Show Description
pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1148 |
C. elegans |
dpy-20(e1282) IV; pkIs689. Show Description
pkIs689 [gpa-1::GFP + dpy-20(+)]. Reporter construct includes 1.5 kb upstream and the first 8 exons of gpa-1 fused in frame with GFP. 4.3 kb HindIII - BglII fragment cloned in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL1533 |
C. elegans |
dpy-20(e1282) IV; pkIs533. Show Description
pkIs533[gpa-10XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1575 |
C. elegans |
dpy-20(e1282) IV; pkIs575. Show Description
pkIs575 [gpc-1::GFP + dpy-20(+)]. Reporter construct includes 4.2 kbp of upstream sequences, and most of the gpc-1 coding region, fused in-frame to GFP. 5.0 kbp XbaI - ScaI fragment cloned into pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.
|
|
| NL1581 |
C. elegans |
dpy-20(e1282) IV; pkIs503. Show Description
pkIs503[gpa-1XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1584 |
C. elegans |
dpy-20(e1282) IV; pkIs515. Show Description
pkIs515 [gpa-4XS(+) + dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1585 |
C. elegans |
dpy-20(e1282) IV; pkIs519. Show Description
pkIs519 [gpa-6XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1586 |
C. elegans |
dpy-20(e1282) IV; pkIs523. Show Description
pkIs523 [gpa-7(+) + dpy-20(+)].
|
|
| NL1587 |
C. elegans |
dpy-20(e1282) IV; pkIs527. Show Description
pkIs527 [gpa-8XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1588 |
C. elegans |
dpy-20(e1282) IV; pkIs531. Show Description
pkIs531[gpa-9XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
|
|
| NL1590 |
C. elegans |
dpy-20(e1282) IV; pkIs539. Show Description
pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1593 |
C. elegans |
dpy-20(e1282) IV; pkIs552. Show Description
pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1594 |
C. elegans |
dpy-20(e1282) IV; pkIs555. Show Description
pkIs555 [gpa-15XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
|
|
| NL1598 |
C. elegans |
dpy-20(e1282) IV; pkIs571. Show Description
pkIs571[gpc-1XS dpy-20(+)]. No morphological changes. Locomotion and egg laying are slightly reduced.
|
|
| NL1602 |
C. elegans |
dpy-20(e1282) IV; pkIs582. Show Description
pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL1603 |
C. elegans |
dpy-20(e1282) IV; pkIs583. Show Description
pkIs583 [gpa-6::GFP + dpy-20(+)]. GFP expression in AWA, ASI and PHB. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL1604 |
C. elegans |
dpy-20(e1282) IV; pkIs584. Show Description
pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.
|
|
| NL1606 |
C. elegans |
dpy-20(e1282) IV; pkIs586. Show Description
pkIs586 [gpa-9::GFP + dpy-20(+)]. GFP expression in ASJ, PHB, PVQ, pharynx muscle and spermatheca.
|
|
| NL1607 |
C. elegans |
dpy-20(e1282) IV; pkIs587. Show Description
pkIs587 [gpa-10::GFP + dpy-20(+)].
|
|
| NL1608 |
C. elegans |
dpy-20(e1282) IV; pkIs588. Show Description
pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL1609 |
C. elegans |
dpy-20(e1282) IV; pkIs589. Show Description
pkIs589 [gpa-13::GFP + dpy-20(+)]. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL1610 |
C. elegans |
dpy-20(e1282) IV; pkIs590. Show Description
pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.
|
|
| NL1611 |
C. elegans |
dpy-20(e1282) IV; pkIs591. Show Description
pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.
|
|
| NL2328 |
C. elegans |
dpy-20(e1282) IV; pkIs1269. Show Description
pkIs1269 [gpa-13XS(+) + dpy-20(+)].
|
|
| NL2334 |
C. elegans |
dpy-20(e1282) IV; pkIs1273. Show Description
pkIs1273 [gpa-16::GFP + dpy-20(+)].
|
|
| NL2336 |
C. elegans |
dpy-20(e1282) IV; pkIs1275. Show Description
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.
|
|
| NL3161 |
C. elegans |
pkIs1330 I; tpa-1(pk1401) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
|
|
| NL4258 |
C. elegans |
pkIs1330 I; tpa-1(pk1585) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
|
|
| NW906 |
C. elegans |
pag-1(ls2) III; dpy-20(e1282) IV; seu-2(ev523) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
|
|
| NW988 |
C. elegans |
pag-1(ls2) III; dpy-20(e1282) IV; seu-3(ev555) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
|
|
| PD4251 |
C. elegans |
ccIs4251 I; dpy-20(e1282) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).
|
|
| PD4443 |
C. elegans |
ccIs4443 IV. Show Description
ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.
|
|
| PD4655 |
C. elegans |
dpy-20(e1282) IV; ccIs4655. Show Description
ccIs4655 [pes-10::GFP + dpy-20(+) ]. GFP expression in lineages with active HLH-8/HLH-2 (e.g., sex muscle, head mesodermal cell). Transgene contains pes-10::GFP reporter driven by 8 copies of an HLH-8/HLH-2 response site from the ceh-24 promoter.
|
|
| PD4666 |
C. elegans |
ayIs6 X. Show Description
ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
|
|
| PD4667 |
C. elegans |
ayIs7 IV. Show Description
ayIs7 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
|
|
| PS1595 |
C. elegans |
lfe-2(sy326) I; lin-3(n1058) dpy-20(e1282) IV. Show Description
sy326 suppresses the sterility of n1058. Dpy.
|
|
| PS1631 |
C. elegans |
itr-1(sy290) dpy-20(e1282) IV. Show Description
|
|
| PS1681 |
C. elegans |
dpy-20(e1282) IV; syIs17. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)].
|
|
| PS1702 |
C. elegans |
dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS1922 |
C. elegans |
dpy-20(e1282) syIs24 IV. Show Description
syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2105 |
C. elegans |
dpy-20(e1282) IV; syIs13. Show Description
syIs13 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2109 |
C. elegans |
dpy-20(e1282) IV; syIs25 X. Show Description
syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2399 |
C. elegans |
dpy-20(e1282) IV; syIs30 X. Show Description
syIs30 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2442 |
C. elegans |
dpy-20(e1282) IV; syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2444 |
C. elegans |
dpy-20(e1282) IV; syIs36. Show Description
syIs36 [(pLB2) egl-30(+) + pBS + (pMH86) dpy-20(+)]. Integrated version of syEx126 (egl-30 over-expressing line). Easily reverted. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2467 |
C. elegans |
dpy-20(e1282) IV; syEx178. Show Description
syEx178 [hsp16.1::egl-5 + (pMH86) dpy-20(+) + pBS]. Heat-shock egl-5. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2746 |
C. elegans |
dpy-20(e1282) IV; syEx234. Show Description
syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2767 |
C. elegans |
hmg-1.2(sy549) III; dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.
|
|