Search Strains

wdIs20 [unc-4p::snb-1::GFP + dpy-20(+)]. Animals are Lon, likely due to dpy-20(+) overexpression. Punctate GFP expression observed in dorsal nerve cord, ventral nerve cord, VC4, and VC5. Reference: Lickteig KM, et al. J Neurosci. 2001 Mar 15;21(6):2001-14.

ayIs4 [egl-17p::GFP + dpy-20(+)] IV.

pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs689 [gpa-1::GFP + dpy-20(+)]. Reporter construct includes 1.5 kb upstream and the first 8 exons of gpa-1 fused in frame with GFP. 4.3 kb HindIII - BglII fragment cloned in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs533[gpa-10XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs575 [gpc-1::GFP + dpy-20(+)]. Reporter construct includes 4.2 kbp of upstream sequences, and most of the gpc-1 coding region, fused in-frame to GFP. 5.0 kbp XbaI - ScaI fragment cloned into pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

pkIs503[gpa-1XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs515 [gpa-4XS(+) + dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs519 [gpa-6XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs523 [gpa-7(+) + dpy-20(+)].

pkIs527 [gpa-8XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs531[gpa-9XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs555 [gpa-15XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs571[gpc-1XS dpy-20(+)]. No morphological changes. Locomotion and egg laying are slightly reduced.

pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs583 [gpa-6::GFP + dpy-20(+)]. GFP expression in AWA, ASI and PHB. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.

pkIs586 [gpa-9::GFP + dpy-20(+)]. GFP expression in ASJ, PHB, PVQ, pharynx muscle and spermatheca.

pkIs587 [gpa-10::GFP + dpy-20(+)].

pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs589 [gpa-13::GFP + dpy-20(+)]. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.

pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.

pkIs1269 [gpa-13XS(+) + dpy-20(+)].

pkIs1273 [gpa-16::GFP + dpy-20(+)].

pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.

pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.

evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.

evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).

ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.

ccIs4655 [pes-10::GFP + dpy-20(+) ]. GFP expression in lineages with active HLH-8/HLH-2 (e.g., sex muscle, head mesodermal cell). Transgene contains pes-10::GFP reporter driven by 8 copies of an HLH-8/HLH-2 response site from the ceh-24 promoter.

ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.

ayIs7 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.

sy326 suppresses the sterility of n1058. Dpy.

syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)].

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC.

syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC.

syIs13 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC.

syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC.

syIs30 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC.

syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC.

syIs36 [(pLB2) egl-30(+) + pBS + (pMH86) dpy-20(+)]. Integrated version of syEx126 (egl-30 over-expressing line). Easily reverted. Do not distribute this strain; other labs should request it from the CGC.

syEx178 [hsp16.1::egl-5 + (pMH86) dpy-20(+) + pBS]. Heat-shock egl-5. Do not distribute this strain; other labs should request it from the CGC.

syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC.

syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC.