Search Strains

More Fields
Strain Species Genotype Add
RB1793 C. elegans Y24D9A.2(ok2320) IV. Show Description
Y24D9A.2 Homozygous. Outer Left Sequence: aattcgcgaaaacgaaacaa. Outer Right Sequence: attgacggagaaaagagcga. Inner Left Sequence: ctccaatgcctgtagatgcc. Inner Right Sequence: aaaattgggaaaatggtggg. Inner Primer PCR Length: 3188. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1794 C. elegans F53A2.7(ok2322) III. Show Description
F53A2.7 Homozygous. Outer Left Sequence: gaagaagaccagctcggttg. Outer Right Sequence: accttcgaaatgccaatgtc. Inner Left Sequence: gccattctgcttctttttcg. Inner Right Sequence: ccgatctgaaaattggcatt. Inner Primer PCR Length: 2349. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1795 C. elegans fat-1(ok2323) IV. Show Description
Y67H2A.8 Homozygous. Outer Left Sequence: cgcaatgagactggcttaca. Outer Right Sequence: taagttcctgcaaaacgcct. Inner Left Sequence: gtcgctcattcctcagaagg. Inner Right Sequence: agttgaaccacaggaaacgg. Inner Primer PCR Length: 2875. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1796 C. elegans set-21(ok2327) IV. Show Description
Y24D9A.2. Homozygous. Outer Left Sequence: AATTCGCGAAAACGAAACAA. Outer Right Sequence: ATTGACGGAGAAAAGAGCGA. Inner Left Sequence: CTCCAATGCCTGTAGATGCC. Inner Right Sequence: AAAATTGGGAAAATGGTGGG. Inner Primer PCR Length: 3169 bp. Deletion Size: 1604 bp. Deletion left flank: TTTGCTGGCAGAACAGGGCACATCGACGGA. Deletion right flank: CACTCGGTACGATAAATGGAACAAGGATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1797 C. elegans citk-1(ok2328) II. Show Description
W02B8.2. Homozygous. Outer Left Sequence: CAAATTTGCCGAACATTTCA. Outer Right Sequence: TGCTTCATGTCTACAAGGCG. Inner Left Sequence: GAAATTTGCCGATTTGCC. Inner Right Sequence: TAAACCGGCCTCGTGTCTAC. Inner Primer PCR Length: 3065 bp. Deletion Size: 1711 bp. Deletion left flank: CTCAAGGTGGAAGAGGAGCTCCAGGAGAAG. Deletion right flank: GGCACAAGGCCTCAAGGTAGACGTAGGTAA. Insertion Sequence: CCTATACTTACCTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1798 C. elegans zig-7(ok2329) I. Show Description
F54D7.4. Homozygous. Outer Left Sequence: AGCGAGAGACGCAGAGAAAC. Outer Right Sequence: ATTTTCCCAATGTCAACCCA. Inner Left Sequence: AGAAAGGGGGAAACTCGGT. Inner Right Sequence: TGCTTGGCGAGTCTAGTGAA. Inner Primer PCR Length: 3106 bp. Deletion Size: 1931 bp. Deletion left flank: GAATCGATGAGTTTTATTTTCTCGTTTGCC. Deletion right flank: AGAAATTAATTTTTCAAAAAAAGAAAGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1799 C. elegans Y71F9B.8(ok2333) I. Show Description
Y71F9B.8. Homozygous. Outer Left Sequence: ACAACCTGATGAGGGGTGAG. Outer Right Sequence: TGCCGGAATTGAAATTCTTC. Inner Left Sequence: TCGTTTGAACAATCGGAACA. Inner Right Sequence: TCCAGACCCTCATCATCTCC. Inner Primer PCR Length: 2841 bp. Deletion Size: 1153 bp. Deletion left flank: TGAAAATCTAGAGTCTTGTAATTGGGACTT. Deletion right flank: ATTTTTTGTAGATCAAACCGTGATGGGACA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1800 C. elegans gpa-17(ok2334) III. Show Description
Y71H2B.7. Homozygous. Outer Left Sequence: GCCTCCTCAATCCTCAATCA. Outer Right Sequence: TTCCAGTACACAATCGCCTG. Inner Left Sequence: GAAGACGGCAATGATACGGT. Inner Right Sequence: TTGAGCATCAGTTGCCTGAG. Inner Primer PCR Length: 2552 bp. Deletion Size: 1693 bp. Deletion left flank: TTTCCAATTAGTGGTGGTGATTTTTGCCTG. Deletion right flank: AGGGAAAAAAGGGAAAACCGGAGAATTATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1801 C. elegans csb-1(ok2335) X. Show Description
F53H4.1. Homozygous. Outer Left Sequence: ACAACTGGGAGAAAACCGTG. Outer Right Sequence: AGGAAGGTGTCGAGTGGTTG. Inner Left Sequence: GGCTGGGGGATTCAAATTAT. Inner Right Sequence: GAAGACTGATCATCGGAGCG. Inner Primer PCR Length: 3043 bp. Deletion Size: 1620 bp. Deletion left flank: CATCCGTTTCTTGGCGGCCTTCTTCTCCAC. Deletion right flank: TCGAGCTTTCGGAAACCACTGGTTCAGCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1802 C. elegans F54E4.4(ok2336) X. Show Description
F54E4.4. Homozygous. Outer Left Sequence: CGATTGGGCCCTATTTAACA. Outer Right Sequence: TACAGCTGCCAGATGGATCA. Inner Left Sequence: TCATGTCTTATGGTGAAATTTTGG. Inner Right Sequence: AAGGAGTGAAGTGTGCAGAATG. Inner Primer PCR Length: 3144 bp. Deletion Size: 1217 bp. Deletion left flank: ACTCACTGTAGTAGTAGTTGTGGGTAAAGT. Deletion right flank: ATAAATGCGGGAAAAGCGGACGATCTTCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1803 C. elegans clec-65(ok2337) II. Show Description
F35C5.8. Homozygous. Outer Left Sequence: TTAATGGTGTTCGGGACCTC. Outer Right Sequence: GGCAAATTTTGACATCGCTT. Inner Left Sequence: AGCAGCATCGCCAACTCTAT. Inner Right Sequence: GCAAATTGCCGGAATTAAAA. Inner Primer PCR Length: 2174 bp. Deletion Size: 1580 bp. Deletion left flank: AACTCTATCCGTCAGTGACAGACGATGCGG. Deletion right flank: GTACTCACTTCTGTGTATTTTTTTTGCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1804 C. elegans T22D1.11(ok2338) IV. Show Description
T22D1.11 Homozygous. Outer Left Sequence: ttggggatgttcaattggtt. Outer Right Sequence: aacgactcaaaagctcagcc. Inner Left Sequence: atattggcagacacgcgatt. Inner Right Sequence: gccagagagctgctcaaaat. Inner Primer PCR Length: 2803. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1805 C. elegans T05E8.1(ok2339) I. Show Description
T05E8.1. Homozygous. Outer Left Sequence: TGTTCCGGTTTCAGCTCTCT. Outer Right Sequence: TTTCCACCAAATCGACATGA. Inner Left Sequence: ACAATCCAAGGACCAACAGC. Inner Right Sequence: CCAGCAAAAATGGCAAATCT. Inner Primer PCR Length: 3175 bp. Deletion Size: 1978 bp. Deletion left flank: TCCTTTGTCTGTACTTCATACAAAACAATG. Deletion right flank: TTATTAGTAATTAAGCATCTTAAGAGTATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1806 C. elegans fbxb-8(ok2340) I. Show Description
F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1807 C. elegans F55G11.2(ok2341) IV. Show Description
F55G11.2. Homozygous. Outer Left Sequence: ATGGCATTTGTTAAGCCCTG. Outer Right Sequence: TAGCTTGTCGTTGTCGTTGC. Inner Left Sequence: TTTGTGTTGTTTGGCTCGTC. Inner Right Sequence: CTTGCGGTCCAAAAGACATT. Inner Primer PCR Length: 2122 bp. Deletion Size: 1155 bp. Deletion left flank: ACTAGCTTCCAAGTTGACTATATTAATATT. Deletion right flank: ACTGTAATTCACAAATTTTAGATAAGTTAA. Insertion Sequence: TTGACTATATTAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1808 C. elegans glr-2(ok2342) III. Show Description
B0280.12. Homozygous. Outer Left Sequence: AGCATCATGAGCAAATGCAG. Outer Right Sequence: ATATTGGTTTCCCTTTCCCG. Inner Left Sequence: TTTCCTCAAGGGCTCTCAAA. Inner Right Sequence: CTCACCTTCTCGGGCAATTA. Inner Primer PCR Length: 2675 bp. Deletion Size: 1229 bp. Deletion left flank: GATATTTCGGAGATTTCTCGTGCAGATATG. Deletion right flank: CAAGCAGTTATTTATGTGCCTACTTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1809 C. elegans ins-30(ok2343) I. Show Description
ZC334.2. Homozygous. Outer Left Sequence: CCATCTGACGTTGCTCAGAA. Outer Right Sequence: GGAGCATGAGCACAACTCAA. Inner Left Sequence: AGGCTCGTAGATGCCAAAAA. Inner Right Sequence: TGATCTACCTCTGCATCCCC. Inner Primer PCR Length: 2309 bp. Deletion Size: 1078 bp. Deletion left flank: TTTTAGAAGACAATTATCAGTTGAAAAATC. Deletion right flank: TTTATCAACAAACTCCTTCCGCAAGTCTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1810 C. elegans cpr-5(ok2344) V. Show Description
W07B8.5. Homozygous. Outer Left Sequence: AATCGAGTCTGCGGTTTCAG. Outer Right Sequence: CAACGTTCTCTCGCATCAAA. Inner Left Sequence: GGTTTTTCACCTCGAATGGA. Inner Right Sequence: TTGTGACACCCCGAAATTCT. Inner Primer PCR Length: 3132 bp. Deletion Size: 2015 bp. Deletion left flank: TTGTTTGTTCCGTCCATTCTACACTGAGTC. Deletion right flank: TTATCAGTTAATTTTATCAGTATCTTTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1811 C. elegans C03B1.5(ok2345) X. Show Description
C03B1.5. Homozygous. Outer Left Sequence: GCGTGTAATCATGCAAATCG. Outer Right Sequence: TTGCATCTTCACAGGCTCAC. Inner Left Sequence: TTGCACGTCCACAATGAAAT. Inner Right Sequence: TGAAAATTGAACACAGGCCA. Inner Primer PCR Length: 2279 bp. Deletion Size: 1310 bp. Deletion left flank: GGCGATACTTCTCTATTCCTTATGAAGGAC. Deletion right flank: TTCTCAAGGGAGAGAATCCGTTCAAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1812 C. elegans atn-1(ok84) V. Show Description
W04D2.1 Homozygous. Outer Left Sequence: agatgccattgacaccttcc. Outer Right Sequence: tattctgtctgtaccggacg. Inner Left Sequence: attcacagcctggtgcaact. Inner Right Sequence: atggaatcgcttcgtgtcgg. Deletion size: about 1136 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1813 C. elegans F39B1.1(ok2346) X. Show Description
F39B1.1. Homozygous. Outer Left Sequence: ACATGGAACATTTCGGTGGT. Outer Right Sequence: AACGCAACGTCACTCTTGTG. Inner Left Sequence: GCCGATCTCCAATACCAAGA. Inner Right Sequence: CTGCTGCATCGAAAGTCGTA. Inner Primer PCR Length: 3242 bp. Deletion Size: 1597 bp. Deletion left flank: CGCATGTCATCGTCACGCTGGAAAGCATCA. Deletion right flank: TAACACTTACATAAAGGTCCAATGGAATCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1814 C. elegans R151.1&R151.4(ok2347) III. Show Description
R151.4, R151.1. Homozygous. Outer Left Sequence: GTGCAAAGCCATATCCACCT. Outer Right Sequence: CGTGGGTCTCTATCGGTTGT. Inner Left Sequence: TTTTCCTAATTGTGGTCGCC. Inner Right Sequence: CAGCAGTCTGAACCCTCTCC. Inner Primer PCR Length: 2360 bp. Deletion Size: 1306 bp. Deletion left flank: ATATTCTATATCGACCACCAAATGAAGTAA. Deletion right flank: CAATGTGGCAGATAAGGATATTCTAAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1815 C. elegans vit-3(ok2348) X. Show Description
F59D8.1 Homozygous. Outer Left Sequence: atgcggtcgttctcaacttc. Outer Right Sequence: gcacattgctgaccttctca. Inner Left Sequence: cggtggaattcctcaacatc. Inner Right Sequence: ggatttgcttcaaagaccca. Inner Primer PCR Length: 3061. Deletion size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1816 C. elegans gpa-16(ok2349) I. Show Description
Y95B8A.5 Homozygous. Outer Left Sequence: agcgcaatggggtgtattat. Outer Right Sequence: cgaatcggaccaaacactct. Inner Left Sequence: agcgaaacgaagatccaaga. Inner Right Sequence: attcgtgatcgagtgtggtg. Inner Primer PCR Length: 3358. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1817 C. elegans mop-25.3(ok2350) I. Show Description
T27C10.3. Homozygous. Outer Left Sequence: TTTACGGGGCTCGTATTTTG. Outer Right Sequence: TACAGTAATCCATGCGGCAG. Inner Left Sequence: GAGCCCGTAAATCGAGACAA. Inner Right Sequence: GGAACGGATTTCCGAATTTT. Inner Primer PCR Length: 2264 bp. Deletion Size: 1005 bp. Deletion left flank: GAATGAGCTCTTCACTGCTCAAACAAACTA. Deletion right flank: AGACTTCCGAAAGTGAATCACGTCTACCGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1818 C. elegans C18B2.6(ok2353) X. Show Description
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 2211 bp. Deletion left flank: CCGACTGTGTGACGTACTATTTCTGCGACG. Deletion right flank: AATATTCTCGAAAGGCAGATCCATGGACGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1819 C. elegans Y62H9A.9(ok2354) X. Show Description
Y62H9A.9 Homozygous. Outer Left Sequence: cctgaactccaaggaccaaa. Outer Right Sequence: ctccaatttccgttcttcca. Inner Left Sequence: ttcctaaattgtccccctcc. Inner Right Sequence: tcaaaaatccatcccatcgt. Inner Primer PCR Length: 3238. Deletion size: about 3000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1820 C. elegans T25F10.6(ok2355) V. Show Description
T25F10.6. Homozygous. Outer Left Sequence: TGAATAGACGTGTCGTTGCC. Outer Right Sequence: CCTCATTCTGGGACGTGTTT. Inner Left Sequence: ATGTGGGTGGAGATGATGGT. Inner Right Sequence: TGACGTCGAAGACGAGTACG. Inner Primer PCR Length: 2512 bp. Deletion Size: 1021 bp. Deletion left flank: GACTCCCATCTGGTATGGAATCATTCCCTG. Deletion right flank: CTTGAATTGGGATAATTCCCTCGGATCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1821 C. elegans K10G9.1(ok2356) III. Show Description
K10G9.1. Homozygous. Outer Left Sequence: AGACCTGTGAGATGTCCGCT. Outer Right Sequence: GGCTCTTCAGGCACAACTTC. Inner Left Sequence: GCAGAACCCTCAAGAAGTCG. Inner Right Sequence: TTGCGTCTCGTTCAGAACAC. Inner Primer PCR Length: 3066 bp. Deletion Size: 1936 bp. Deletion left flank: TAGCTGTGAAGAATATGACGGTGAGTGTCT. Deletion right flank: CGAAATTTTCAGAATGGAGGAAGAAAGAGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1822 C. elegans elp-1(ok2357) V. Show Description
F38A6.2. Homozygous. Outer Left Sequence: CACCATACCATCACTTCCCC. Outer Right Sequence: TGTCTCCACCGTGACACAAT. Inner Left Sequence: AATCAGTGACCGGAATCTGC. Inner Right Sequence: GGAGTAGCGCAAGTAGGGAA. Inner Primer PCR Length: 2857 bp. Deletion Size: 1416 bp. Deletion left flank: CAAAAATAACGAAAATGACGTCACTCAATT. Deletion right flank: ACTAAATTTTTTAACGTTTATGTTTTTAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1823 C. elegans gst-4&msp-38(ok2358) IV. Show Description
K08F4.7, K08F4.8. Homozygous. Outer Left Sequence: ATGCTGGGTGAAACTAACGG. Outer Right Sequence: AAAGATCTGGGGCAGTGATG. Inner Left Sequence: TCCTCGAACATCGAAACACA. Inner Right Sequence: AAGGTGATCAACTCATCGGC. Inner Primer PCR Length: 2170 bp. Deletion Size: 1548 bp. Deletion left flank: CAAACCTTGGGCAAGAATTTCCAGAGATTG. Deletion right flank: GAATTGTTTGGCAGCGCCATCCGGGGTGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1824 C. elegans C18B2.6(ok2360) X. Show Description
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 1608 bp. Deletion left flank: ATAGTATATGTCAAGTATAATTTTTCGTTT. Deletion right flank: ATGTTTCTCGTAATAGATATAAGCTGTCGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1825 C. elegans C36B1.12(ok2362) I. Show Description
C36B1.12 Homozygous. Outer Left Sequence: ttccatttggtggttggatt. Outer Right Sequence: gatatcgccaagtcccagaa. Inner Left Sequence: aggctccagatgcgaataga. Inner Right Sequence: catgagcattgggaactgaa. Inner Primer PCR Length: 3358. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1826 C. elegans T26A5.5(ok2364) III. Show Description
T26A5.5. Homozygous. Outer Left Sequence: GTTCGTCAAATCGACTGGGT. Outer Right Sequence: GTTGGAGGCTTCTGTCCATC. Inner Left Sequence: AGGTGGATCTCATTCAACGG. Inner Right Sequence: TTCCTCACTTCCTCGTTTCG. Inner Primer PCR Length: 3244 bp. Deletion Size: 1461 bp. Deletion left flank: TTCTGCATGCGTCTCTATGGCCTCAAACTG. Deletion right flank: GCATTTGTTGGTGGACTTCCAACTTCATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1827 C. elegans hum-6(ok2365) X. Show Description
T10H10.1. Homozygous. Outer Left Sequence: GGGGAACGAAACCCATTAGT. Outer Right Sequence: TGGAAAACTGAACTCGAGCA. Inner Left Sequence: TCAAAACCGAAAGAGCACAA. Inner Right Sequence: GCTCTCGATCATCAACCACA. Inner Primer PCR Length: 3314 bp. Deletion Size: 2881 bp. Deletion left flank: TGTACCACACCACAGCTTCGCAGACACCAC. Deletion right flank: TTAGTCTAGTCTGTGTCAATTTTGTTTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1828 C. elegans dgk-5(ok2366) II. Show Description
K06A1.6. Homozygous. Outer Left Sequence: CAGATATTCGGCGGGAGTTA. Outer Right Sequence: ACAGATTTTGAGCCACCCAC. Inner Left Sequence: TCTTGCAGCTGATAACGGTG. Inner Right Sequence: CGACGACCCAGTCGAATTAT. Inner Primer PCR Length: 2725 bp. Deletion Size: 1478 bp. Deletion left flank: AATTATCGTAATCAGCTCTTCCAACCACAA. Deletion right flank: CAAGACGAAGAATCCACGTGGGTGGAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1829 C. elegans F22G12.5(ok2367) I. Show Description
F22G12.5. Homozygous. Outer Left Sequence: GAAAAGGGGTTAGGAGCAGG. Outer Right Sequence: CCCCTAGATCTGACACTGCC. Inner Left Sequence: TCAAATCGGCTAATTTTCGG. Inner Right Sequence: TCGTCTGCATCTGTGTGTCA. Inner Primer PCR Length: 3163 bp. Deletion Size: 1478 bp. Deletion left flank: TAGAGATTTGCCACGGAGATTCTTCGAGCT. Deletion right flank: ACAGCATCCTGTCTAGATCTAGGCTTAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1830 C. elegans C37E2.1(ok2368) X. Show Description
C37E2.1. Homozygous. Outer Left Sequence: TTGGGTTCGTGATTTGTTGA. Outer Right Sequence: CCAAGACCACCGAAACAACT. Inner Left Sequence: ACAAGTTCTGGTGGGGATTG. Inner Right Sequence: AATTTCACAGCTGGCCATTC. Inner Primer PCR Length: 2507 bp. Deletion Size: 1441 bp. Deletion left flank: TACGGAACTTGTCAATGACGGCATCAGCAA. Deletion right flank: GAGCCTCATGTTCAGACCCTGAAGTTCTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1831 C. elegans set-22(ok2370) V. Show Description
Y32F6A.1. Homozygous. Outer Left Sequence: CAATCAAAATGAGTTCGGCA. Outer Right Sequence: TCCTCAACTGATAGACGGGC. Inner Left Sequence: AAATTGGCAACAGACTCAAAAA. Inner Right Sequence: TCTCGATTGAAATTCCCGAG. Inner Primer PCR Length: 3158 bp. Deletion Size: 1483 bp. Deletion left flank: CAACAATGTCTCTTGAGAATTCAAAAATCT. Deletion right flank: AAGATATTTAAATACTTTTAAAACTTTTTA. Insertion Sequence: ATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1832 C. elegans acc-4(ok2371) III. Show Description
T27E9.9 Homozygous. Outer Left Sequence: cgtcctcgccattctcttag. Outer Right Sequence: tttcgccaaaattatctccg. Inner Left Sequence: atccgaggacacagatttgg. Inner Right Sequence: tggccttcgttgtcttcttt. Inner Primer PCR Length: 3018. Deletion size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1833 C. elegans K10B3.5(ok2372) X. Show Description
K10B3.5 Homozygous. Outer Left Sequence: aaagccgttcatgtcaaacc. Outer Right Sequence: acgagagaagacatgggacg. Inner Left Sequence: gagtagtgtgagctgctgcg. Inner Right Sequence: ggtgttccttctcaaatggc. Inner Primer PCR Length: 3221. Deletion size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1834 C. elegans che-7(ok2373) V. Show Description
F26D11.10. Homozygous. Outer Left Sequence: AAAATTCGTCCGAGTCGTTG. Outer Right Sequence: GAGCAGTGGCTCTTTGCTCT. Inner Left Sequence: TGATTCTGGCCATCAGAATTT. Inner Right Sequence: GGGGCACAAAAATGAGAGAA. Inner Primer PCR Length: 3059 bp. Deletion Size: 1496 bp. Deletion left flank: TGCCCACGTACATTATTTTTGTCGCCTGAA. Deletion right flank: GCACTGCCATCATAATAAGAAACGATGATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1835 C. elegans F41D9.1(ok2374) X. Show Description
F41D9.1 Homozygous. Outer Left Sequence: tcgtgctccactctcatttg. Outer Right Sequence: gttgaaccgatcggaagaga. Inner Left Sequence: aagaaaggtgagcgctgtgt. Inner Right Sequence: gccttgtggcctaatggata. Inner Primer PCR Length: 3251. Deletion size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1836 C. elegans W05B5.2(ok2375) I. Show Description
W05B5.2 Homozygous. Outer Left Sequence: acgttaagaaaccgcctttg. Outer Right Sequence: cggaatcgtcctgaaatgtt. Inner Left Sequence: aagtctccaccaatgcaaaa. Inner Right Sequence: ttctttcttttatttttcggtttca. Inner Primer PCR Length: 3143. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1837 C. elegans C54A12.2(ok2376) II. Show Description
C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1839 C. elegans C18H2.2(ok2379) III. Show Description
C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1840 C. elegans M28.8(ok2380) II. Show Description
M28.8. Homozygous. Outer Left Sequence: AACTCCAGCTCGCAATGAAT. Outer Right Sequence: GCCAAGGTTTGCAAGTTTGT. Inner Left Sequence: TGTGCTCAGTATTCGGGATCT. Inner Right Sequence: ACAAACCGACAGATTTGCCT. Inner Primer PCR Length: 3039 bp. Deletion Size: 2145 bp. Deletion left flank: TGAACCTCTTTGTTTGTTCTTATCAATTTA. Deletion right flank: TTAATATCGGGTAAGACAAATTAGTGTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1841 C. elegans Y32G9A.8(ok2383) V. Show Description
Y32G9A.8 Homozygous. Outer Left Sequence: gcacagggaactggtttgtt. Outer Right Sequence: ggtaccgtctttttgggaca. Inner Left Sequence: gtcctcttcttgggctcctt. Inner Right Sequence: cagccaaaaatacactgcga. Inner Primer PCR Length: 2685. Deletion size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1842 C. elegans Y54E10A.3(ok2384) I. Show Description
Y54E10A.3. Homozygous. Outer Left Sequence: CACCATGCCAGTTATCAACG. Outer Right Sequence: CCGAAAAATTGTTTTGCAGC. Inner Left Sequence: TCGATTTCACTGCAGTCTGG. Inner Right Sequence: TGACATATTTCAACGCGACG. Inner Primer PCR Length: 2527 bp. Deletion Size: 1157 bp. Deletion left flank: TTCTGACAATAAAATAAACTTTATTTTTTA. Deletion right flank: TTAGAAAATATCCGAAAAAAATATCCGCCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1843 C. elegans lin-42(ok2385) II. Show Description
F47F6.1. Homozygous. Outer Left Sequence: CGGTTACGCATTGAAAGACA. Outer Right Sequence: AGTCCCTTTTGCCTGGATCT. Inner Left Sequence: TTTTGCAGGAAACGTAAAGGA. Inner Right Sequence: AGGGGCCTGATCCTAAGAAA. Inner Primer PCR Length: 3109 bp. Deletion Size: 2632 bp. Deletion left flank: CCGGGTTCAGGCCCATATAGGCCTATAGGC. Deletion right flank: ACGGGGGGCTACCCGGCTGGGTGGGAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807