Search Strains

More Fields
Strain Species Genotype Add
MQ228 C. elegans mad-2(qm62) I. Show Description
Maternal effect dumpy. Adults are short but larvae are not. Animals are lethargic but display hyperactive foraging movement and very rapid pumping when stimulated by light touch. Hermaphrodite and male tails are abnormal. Very slow development. High degree of embryonic and larval lethality.
MQ499 C. elegans mad-3(qm64) V. Show Description
Maternal effect Dpy. High level of embryonic and larval lethality. Lethal at 25C. Males are Dpy.
MT19851 C. elegans sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
NM6007 C. elegans jsSi1901 II. Show Description
jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6024 C. elegans jsSi2029 IV. Show Description
jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6037 C. elegans jsSi2049 V. Show Description
jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6168 C. elegans jsSi2027 II; him-8(e1489) IV. Show Description
jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM664 C. elegans jsIs37 IV; lin-15B&lin-15A(n765) X. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.
NM6805 C. elegans jsSi2615 II; jsSi1784 IV. Show Description
jsSi2615 [loxP attP rps-7 3' FRT3] II. jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Expressses phiC31 and FLP recombinases and mNG in germline. Strain contains an unmarked phiC31 attP landing site on Chr II. Reference: Nonet ML. bioRxiv 2024.03.01.583017.
NM6927 C. elegans jsSi2682 IV. Show Description
jsSi2682 [attP mex-5p::FLP::SL2::mNeonGreen::UTR Cbr-unc-119(+) attL::mex-5Kp::phiC31] IV. Inserted at cxTi10882 on IV. Transgene expressing FLP and phiC31 recombinases and mNG in the germline for performing Recombination Mediated Insertion (RMI) transgenesis and Recombination Mediated Homolog Exchange (RMHE). Reference: Nonet ML. bioRxiv 2024.03.01.583017.
OH16377 C. elegans ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X. Show Description
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341.
OH17055 C. elegans ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otDf1 X; otIs790. Show Description
otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH18465 C. elegans ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
PJ1196 C. elegans daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C. NOTE: m62 is an amber allele of daf-7, which is well suppressed by sup-7 in ccIs55 at 16C.
PJ1199 C. elegans daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Constitutive dauer formation at 25C.
QQ253 C. elegans daf-16(mgDf50) I; daf-2(m65) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Maintain at 15C. Derived from parental strains GA158 and JJ1473. Reference: Simske J & Dong Y. 2017). The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis presented in International Worm Meeting.
RB2201 C. elegans M60.6(ok2981) X. Show Description
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB883 C. elegans kqt-2(ok732) X. Show Description
M60.5. Homozygous. Outer Left Sequence: TCTTTGTCGGAGAAGCCACT. Outer Right Sequence: GCAAATTCAAAAGTTGGGGA. Inner Left Sequence: GAGAATGCCGGAAAATTCAA. Inner Right Sequence: TGGCAATAAAGTGACGCTTG. Inner primer WT PCR product: 3213. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SOL19 C. elegans ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs669 him-5(e1490) V; otDf1 X. Show Description
NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.
TP69 C. elegans pdi-2(tm689)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile. Maintain at 15 degrees.
UP3542 C. elegans lpr-3(cs231) X; csEx436. Show Description
csEx436 [lpr-3 (fosmid WRM619dE09) + myo-2p::mCherry]. Pick mCherry+ animals to maintain. cs231 is a Crispr/Cas9-induced null allele of lpr-3: a 13 nucleotide deletion in exon 1 results in frameshift. Homozygous mutants are embryonic lethal, but are rescued by csEx436 containing lpr-3(+) fosmid WRM619dE09. NOTE: lpr-3(cs231) should be considered the canonical allele as ok2351 also perturbs expression of adjacent gene lpr-6. Reference: Forman-Rubinsky R, Cohen JD and Sundaram MV. Genetics. 2017 Oct;207(2):625-642.
VJ311 C. elegans erm-1(tm677)/unc-63(x18) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and erm-1 homozygotes which grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
VJ317 C. elegans erm-1(tm677) I; sDp2 (I;f). Show Description
Animals which have lost the Dp grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
WBM60 C. elegans uthIs248. Show Description
uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WM65 C. elegans src-1(cj293) let-502(sb118)/hT1 I; +/hT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]
WRM66 C. elegans oma-1(ne5035[oma-1::GFP]) IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
ZM607 C. elegans syd-2(ok217) X. Show Description
Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
ZM6523 C. elegans hpDf761 II; unc-119(ed3) III. Show Description
hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM6539 C. elegans unc-39(hp701) V. Show Description
Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM6610 C. elegans nlf-1(hp428) X. Show Description
Fainter. hp428 is a G to A substitution that alters the 3? splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.
ZM6660 C. elegans got-1.2(hp731) X. Show Description
got-1.2(hp731) is C184Y substitution mutation. Reference: Chitturi J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. PMID: 29649217.
ZM6665 C. elegans hpIs268. Show Description
hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Strain allows calcium imaging for D-motor neurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
ZM6686 C. elegans hpIs289. Show Description
hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6725 C. elegans hpIs290. Show Description
hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6804 C. elegans hpIs270. Show Description
hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035