| MQ228 |
C. elegans |
mad-2(qm62) I. Show Description
Maternal effect dumpy. Adults are short but larvae are not. Animals are lethargic but display hyperactive foraging movement and very rapid pumping when stimulated by light touch. Hermaphrodite and male tails are abnormal. Very slow development. High degree of embryonic and larval lethality.
|
|
| MQ499 |
C. elegans |
mad-3(qm64) V. Show Description
Maternal effect Dpy. High level of embryonic and larval lethality. Lethal at 25C. Males are Dpy.
|
|
| MT19851 |
C. elegans |
sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
|
|
| NM6007 |
C. elegans |
jsSi1901 II. Show Description
jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM6024 |
C. elegans |
jsSi2029 IV. Show Description
jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM6037 |
C. elegans |
jsSi2049 V. Show Description
jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM6168 |
C. elegans |
jsSi2027 II; him-8(e1489) IV. Show Description
jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
| NM664 |
C. elegans |
jsIs37 IV; lin-15B&lin-15A(n765) X. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.
|
|
| NM6805 |
C. elegans |
jsSi2615 II; jsSi1784 IV. Show Description
jsSi2615 [loxP attP rps-7 3' FRT3] II. jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Expressses phiC31 and FLP recombinases and mNG in germline. Strain contains an unmarked phiC31 attP landing site on Chr II. Reference: Nonet ML. bioRxiv 2024.03.01.583017.
|
|
| NM6927 |
C. elegans |
jsSi2682 IV. Show Description
jsSi2682 [attP mex-5p::FLP::SL2::mNeonGreen::UTR Cbr-unc-119(+) attL::mex-5Kp::phiC31] IV. Inserted at cxTi10882 on IV. Transgene expressing FLP and phiC31 recombinases and mNG in the germline for performing Recombination Mediated Insertion (RMI) transgenesis and Recombination Mediated Homolog Exchange (RMHE). Reference: Nonet ML. bioRxiv 2024.03.01.583017.
|
|
| OH16377 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X. Show Description
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341.
|
|
| OH17055 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otDf1 X; otIs790. Show Description
otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH18465 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PJ1196 |
C. elegans |
daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C. NOTE: m62 is an amber allele of daf-7, which is well suppressed by sup-7 in ccIs55 at 16C.
|
|
| PJ1199 |
C. elegans |
daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Constitutive dauer formation at 25C.
|
|
| QQ253 |
C. elegans |
daf-16(mgDf50) I; daf-2(m65) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Maintain at 15C. Derived from parental strains GA158 and JJ1473. Reference: Simske J & Dong Y. 2017). The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis presented in International Worm Meeting.
|
|
| RB2201 |
C. elegans |
M60.6(ok2981) X. Show Description
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB883 |
C. elegans |
kqt-2(ok732) X. Show Description
M60.5. Homozygous. Outer Left Sequence: TCTTTGTCGGAGAAGCCACT. Outer Right Sequence: GCAAATTCAAAAGTTGGGGA. Inner Left Sequence: GAGAATGCCGGAAAATTCAA. Inner Right Sequence: TGGCAATAAAGTGACGCTTG. Inner primer WT PCR product: 3213. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| SOL19 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs669 him-5(e1490) V; otDf1 X. Show Description
NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.
|
|
| TP69 |
C. elegans |
pdi-2(tm689)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile. Maintain at 15 degrees.
|
|
| UP3542 |
C. elegans |
lpr-3(cs231) X; csEx436. Show Description
csEx436 [lpr-3 (fosmid WRM619dE09) + myo-2p::mCherry]. Pick mCherry+ animals to maintain. cs231 is a Crispr/Cas9-induced null allele of lpr-3: a 13 nucleotide deletion in exon 1 results in frameshift. Homozygous mutants are embryonic lethal, but are rescued by csEx436 containing lpr-3(+) fosmid WRM619dE09. NOTE: lpr-3(cs231) should be considered the canonical allele as ok2351 also perturbs expression of adjacent gene lpr-6. Reference: Forman-Rubinsky R, Cohen JD and Sundaram MV. Genetics. 2017 Oct;207(2):625-642.
|
|
| VJ311 |
C. elegans |
erm-1(tm677)/unc-63(x18) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and erm-1 homozygotes which grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
|
|
| VJ317 |
C. elegans |
erm-1(tm677) I; sDp2 (I;f). Show Description
Animals which have lost the Dp grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
|
|
| WBM60 |
C. elegans |
uthIs248. Show Description
uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
|
|
| WM65 |
C. elegans |
src-1(cj293) let-502(sb118)/hT1 I; +/hT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]
|
|
| WRM66 |
C. elegans |
oma-1(ne5035[oma-1::GFP]) IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
|
|
| ZM607 |
C. elegans |
syd-2(ok217) X. Show Description
Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
|
|
| ZM6523 |
C. elegans |
hpDf761 II; unc-119(ed3) III. Show Description
hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
|
|
| ZM6539 |
C. elegans |
unc-39(hp701) V. Show Description
Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
| ZM6610 |
C. elegans |
nlf-1(hp428) X. Show Description
Fainter. hp428 is a G to A substitution that alters the 3′ splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.
|
|
| ZM6660 |
C. elegans |
got-1.2(hp731) X. Show Description
got-1.2(hp731) is C184Y substitution mutation. Reference: Chitturi J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. PMID: 29649217.
|
|
| ZM6665 |
C. elegans |
hpIs268. Show Description
hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Strain allows calcium imaging for D-motor neurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
|
|
| ZM6686 |
C. elegans |
hpIs289. Show Description
hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
|
|
| ZM6725 |
C. elegans |
hpIs290. Show Description
hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
|
|
| ZM6804 |
C. elegans |
hpIs270. Show Description
hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
|
|