Search Strains

This strain is homozygous for a deletion (gk1068) in Y53F4B.4 and Y53F4B.42, detectable by PCR using the following primers. External left primer: GGCAAAATTGTACGCATCCT. External right primer: CTTGTTTCGCTCGATTCACA. Internal left primer: TCTCGTTAGGTATTTGCGGC. Internal right primer: CGCAACTGCGTTAAATCGTA. Internal WT amplicon: 2605 bp. Deletion size: 557 bp. Deletion left flank: AATAGAAAATGCATTTTAAAATGCGAAAAA. Deletion right flank: CCCGATTTTTGACCGATGACACCAAAGTTT. Validation: gk1068 passed by CGH. Other deletions (gk3262, gk3263) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5B.4. External left primer: AAGTTGTCGGAATTGGTTGG. External right primer: TTGCGATTCGAAGAGAGCTT. Internal left primer: CATTGTTCAATATGCACCCAA. Internal right primer: TGGCCACAAAGAAGAAAAGG. Internal WT amplicon: 1138 bp. Deletion size: 684 bp. Deletion left flank: AATTGATGACGCTATTTATGTGAGAACGTG. Deletion right flank: AACGGCACACTGCCGGAATTAAAATTTCCG. Insertion Sequence: TGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43F4B.4. External left primer: CAGCACATTGCCCTACTGAA. External right primer: TTTTCAATGGAAAGGCAAGC. Internal left primer: GAAAACGTACCCCCTCGATT. Internal right primer: TATTCGGCTCCGAGGAGAG. Internal WT amplicon: 1259 bp. Deletion size: 338 bp. Deletion left flank: TGGATGAAAAGTCTTTAAAATGTATCAATT. Deletion right flank: GAAGATTTTTATTTCCAGGTTTCATTCGAT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

[NOTE: Please see RG5007 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5263 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1450 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCTACGTGCTTACCAACATATCTGCCTAAC. Right flanking sequence: AGCGGTAACTTTTCAATTTTCCAATCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 620 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTAAAAAATATTTTTAGAAAATGTCTTCC. Right flanking sequence: AGATCTCTCATAATGTGTTATTTGATACAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Y71A12B.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807