Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AX1296 C. elegans gcy-36(db42) X. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1297 C. elegans gcy-36(db66) X. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1305 C. elegans gcy-34(ok1012) V; npr-1(ad609) X. Show Description
Does not supress aggregation and bordering phenotypes of npr-1(null) animals.
AX1410 C. elegans flp-18(db99) X. Show Description
Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX1789 C. elegans dbEx719. Show Description
dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX1791 C. elegans npr-5(ok1583) V; dbEx720. Show Description
dbEx720 [npr-5::npr-5(cDNA) + unc-122p::GFP]. Pick GFP+ to maintain. Intestinal fat accumulation is similar to wild-type. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX1792 C. elegans dbEx721. Show Description
dbEx721 [npr-4::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in the AVA and RIV neurons, possibly in BAG, in the tail neuron PQR, and in the BDU neurons. Expression was also seen in the coelomocytes, the intestine, and the rectal gland cells. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX2061 C. elegans dbEx813. Show Description
dbEx813 [gcy-37p::cGi500]. Pick GFP+ animals to maintain. The cGi500 cGMP sensor is expressed in the oxygen-sensing AQR, PQR, and URX neurons. Reference: Couto A, et al. Proc Natl Acad Sci U S A. 2013 Aug 27;110(35):E3301-10.
AX2159 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx723. Show Description
dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2164 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx725. Show Description
dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2178 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx726. Show Description
dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX301 C. elegans npr-1(ad609) lin-15B&lin-15A(n765) X; dbEx35. Show Description
dbEx35 [npr-1::GFP + lin-15(+)]. Pick Non-Muv to maintain. Solitary feeders. GFP is expressed in approximately 20 neuron types. Reference: Coates JC, de Bono M. 2002 Nature 419: 925-929.
AX7884 C. elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
AY131 C. elegans zcIs4 V; vit-1(ac2) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-1(ac2) is a dominant allele that causes ER stress. Since vit-1 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY132 C. elegans zcIs4 V; vit-2(ac3) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY133 C. elegans zcIs4 V; vit-4(ac4) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-4(ac4) is a dominant allele that causes ER stress. Since vit-4 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY134 C. elegans zcIs4 V; vit-5(ac5) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-5(ac5) is a dominant allele that causes ER stress. Since vit-5 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY135 C. elegans vit-6(ac6) IV; zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. vit-6(ac6) is a dominant allele that causes ER stress. Since vit-6 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY142 C. elegans vit-2(ac3) X. Show Description
vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY143 C. elegans flp-21(ok889) V; flp-18(gk3063) X. Show Description
Superficially wild-type. Reference: Singh J & Aballay A. Dev Cell. 2019 Apr 8;49(1):89-99.e4.
AY145 C. elegans kyIs262 IV; acEx24. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx24 [srbc-48p::srbc-48(cDNA) + unc-122::GFP]. Maintain by picking GFP+ to maintain array. Integrated RFP expression in AWB and AWC. Bright GFP expression in coelomocytes. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY146 C. elegans kyIs262 IV; acEx25. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx25 [odr-1p::srbc-48::GFP]. Maintain by picking GFP+ to maintain array. Extra-chromosomal GFP expression in AWC neurons. Integrated RFP expression in AWB and AWC. acEx25 rescues srbc-48 mediated defects. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY147 C. elegans acEx26. Show Description
acEx26 [odr-1p::RFP]. Pick RFP+ to maintain. RFP expression in AWC and AWB. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY156 C. elegans acIs156. Show Description
acIs156 [vit-2p::vit-2(G839R)::GFP + myo-2p::mCherry]. In contrast to VIT-2::GFP, VIT-2(G839R)::GFP remains in the intestine and is not transported to embryos. mCherry expression in pharynx. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY157 C. elegans gon-2(q388) I; acEx157. Show Description
acEx157 [gon-2p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in intestine and gonads). gon-2 expression driven by gon-2 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY158 C. elegans gon-2(q388) I; acEx158. Show Description
acEx158 [ges-1p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in intestinal cells). gon-2 expression driven by ges-1 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY159 C. elegans gtl-2(n2618) IV; acEx159. Show Description
acEx159 [gtl-2p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in the excretory cell and pharynx). gtl-2 expression driven by gtl-2 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY160 C. elegans gtl-2(n2618) IV; acEx160. Show Description
acEx160 [sulp-4p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in the excretory cell). gtl-2 expression driven by sulp-4 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY161 C. elegans mul-1(syb1027) IV. Show Description
F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AY162 C. elegans mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AY172 C. elegans mrp-1(pk89) X; acEx172. Show Description
acEx172 [mrp-1p::mrp-1C::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. mrp-1C (isoform C from cDNA) expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY173 C. elegans mrp-1(pk89) X; acEx173. Show Description
acEx173 [mrp-1::GFP]. Pick GFP+ animals to maintain. Translationally fused MRP-1::GFP expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY174 C. elegans mrp-1(pk89) X; acEx174. Show Description
acEx174 [ges-1p::mrp-1::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. Translational fusion of MRP-1::GFP driven by intestine-specific ges-1 promoter. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY175 C. elegans nmr-1(ak4) II; acEx175. Show Description
acEx175 [glr-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. glr-1 promoter drives NMR-1 expression primarily in interneuron, neurons, and ventral nerve cord. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY176 C. elegans nmr-1(ak4) II; acEx176. Show Description
acEx176 [dc-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. tdc-1 promoter drives NMR-1 expression primarily in RIM interneurons. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY177 C. elegans acEx177. Show Description
acEx177 [ges-1p::mrp-1::GFP + vha-6::DsRed + unc-122p::RFP]. Pick RFP+ to maintain. Translationally fused MRP-1::GFP expressed under intestinal specific ges-1 promoter, MRP-1::GFP proteins localize at the basolateral membrane of the intestine. Translationally fused VHA-6::RFP expressed under its own promoter, VHA-6::RFP proteins localize at the lumen or luminal membrane of the intestine. For better results, observe fluorescence signals on the L4 stage animals and also under higher magnification microscopy. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
AY178 C. elegans ynIs78; acEx178. Show Description
ynIs78 [flp-8p::GFP]. acEx178 [flp-8p::ced-3 (p15)::nz + flp-32::cz::ced-3 (p17) + unc-122p::RFP]. AUA interneurons ablated in flp-8p::GFP background. GFP-labelled AUA neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.
AY179 C. elegans ynIs87; acEx179. Show Description
ynIs78 [flp-8p::GFP]. acEx179 [flp-21p::ced-3 (p15)::nz + ncs-1p::cz::ced-3 (p17) + unc-122p::RFP]. RMG interneurons ablated in flp-21p::GFP background. GFP-labelled RMG neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.
AY180 C elegans Show Description
Pick animals with roller. The marker used was rol-6.
AY181 C elegans Show Description
Pick animals red-head animal. The marker used was myo-2:mcherry.
AY182 C elegans Show Description
Pick animals red-head animal. The marker used was myo-2:mcherry.
AY183 C elegans Show Description
Pick animals red animal. The marker used was myo-3:mcherry.
AY184 C elegans Show Description
Pick animals with roller. The marker used was rol-6.
AY185 C. elegans acEx185. Show Description
acEx185 [hsp-16.41p::par-5::VN173 + hsp-16.41p::his-1::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. BiFC reporter strain for PAR-5 and histone (H4) proteins interaction. To detect the protein-protein physical interactions, heat shock the animals for 3 hours at 33°C, allow them to recover for 12 hours at 20°C, and observe fluorescent-complementation signals under a high-magnification fluorescence microscope. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.
AY186 C. elegans acEx186. Show Description
acEx186 [hsp-16.41p::par-5::VN173 + hsp-16.41p::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. Control strain for AY185 strain. Heat shock induces protein expression but NO BiFC complementation. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.
AY187 C elegans nhr-8(ok186) IV; acEx187. Show Description
acEx187 [vha-6p::nhr-8::SL2::GFP + rol-6(su1006)]. Pick Rollers to maintain (GFP expression in intestine is easy to see and might be easier to score than Rol). Intestinal rescue of nhr-8(ok186) mutants. Reference: Otarigho B & Aballay A. 2020. iScience. 2020 May 22;23(5):101068. doi: 10.1016/j.isci.2020.101068. PMID: 32361270.
AY188 C elegans unc-30(ok613) IV; acEx188. Show Description
acEx188 [unc-30(+) + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by its own promoter rescues unc-30(ok613). Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.
AY189 C. elegans unc-30(ok613) IV; acEx189. Show Description
acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.
AY190 C. elegans acEx190. Show Description
acEx190 [tax-2p::CZ::ced-3(p17)::unc-54 3’UTR + lim-6p::ced-3(p15)::NZ::unc-54 3’UTR + myo-3p::mCherry]. Pick mCherry+ to maintain.  ASG is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the tax-2 and lim-6 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.
AY191 C elegans acEx191. Show Description
acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain.  PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.