Search Strains

T02D1.5. Homozygous. ABC transporter. Outer Left Sequence: aaacagcctgagacggaatg. Outer Right Sequence: tatgtattggtgcggcttga. Inner Left Sequence: atgccatgacacttgcttca. Inner Right Sequence: atgcaccacctgtgcaaata. Inner primer WT PCR product: 2613. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08F11.14. Homozygous. Outer Left Sequence: CCATCTTCAAGCTTTGCCTC. Outer Right Sequence: CACATTCGTCACCTGAATGC. Inner Left Sequence: CCAAAGTTGAGCACGTGAGA. Inner Right Sequence: GTTGCAAGGACTGATGCAGA. Inner primer WT PCR product: 3374. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E8.4, F49E8.3. Homozygous. Outer Left Sequence: TCTCAACTCCGCTTTTCGTT. Outer Right Sequence: TGAGAAATTCCGATTCTGGG. Inner Left Sequence: ATATTCCAGCTCACCAACGG. Inner Right Sequence: TCTCACCGAACAATATGCCA. Inner primer WT PCR product: 2843. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44D12.1. Homozygous. Outer Left Sequence: AAGAGAGGGATCGACTGCAA. Outer Right Sequence: AGGCAATGAGACGACGGTAG. Inner Left Sequence: AAACTGCTCAGGCAAATGCT. Inner Right Sequence: CCTTGAGCCGTGATATCCAT. Inner primer WT PCR product: 2735. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07A9.6. Homozygous. Outer Left Sequence: CCTCCGACTGCTCCAGTAAC. Outer Right Sequence: AAGGAATGGCTTGAAGCAGA. Inner Left Sequence: CAGCAAAGGAATTGTCCGAT. Inner Right Sequence: CCCACGACAAATTCTCGACT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F4.1. Homozygous. Outer Left Sequence: CGGCCGTTACATTCAAGTTT. Outer Right Sequence: GCACTTCCAATGGGAACACT. Inner Left Sequence: GTACCGGATGCTCATTTGAA. Inner Right Sequence: CTGATCCGTCCAAAATCGTT. Inner primer WT PCR product: 3354. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04D7.3. Homozygous. Outer Left Sequence: ATTTCAACGAGCATTCCTGG. Outer Right Sequence: TGTGCAGCCACAACTTTAGC. Inner Left Sequence: AGGCGTTGAAACAGGAAATG. Inner Right Sequence: GTCAACTGGAGACAACGGGT. Inner primer WT PCR product: 2903. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.24c. Homozygous. Outer Left Sequence: TGGAAAGGGAGAGTCGTTTG. Outer Right Sequence: ACCAACCTGCTTCTGCTGTT. Inner Left Sequence: TCTCCACCACCACAACGTAA. Inner Right Sequence: GCGGAGCAACTCTTCCATAG. Inner primer WT PCR product: 2814. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17H12. Homozygous. Outer Left Sequence: GAAATCCGCCTGAAAAATCA. Outer Right Sequence: GTGAAAACCAAGTGCAGGGT. Inner Left Sequence: AGCATTATCCCCGCATGTAG. Inner Right Sequence: AAACTGGGCGAGGGATTTAG. Inner primer WT PCR product: 2532. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46A5.9. Homozygous. Outer Left Sequence: tcatttcttgcagcaattcgctgttaacactgcgagagcg. Outer Right Sequence: . Inner Left Sequence: attcgaatcgatgatggagc. Inner Right Sequence: aaattgaagttgcaaacccg. Inner primer WT PCR product: 2512. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32E10.7. Homozygous. Outer Left Sequence: CAGGAAACGTCTGTTCAGCA. Outer Right Sequence: CTCGTCTACAGTCGGAAGCC. Inner Left Sequence: TCTGCTCTTCCTCCAACACC. Inner Right Sequence: GTGGTCGATCAGGAATCGTT. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05A12.2. Homozygous. Outer Left Sequence: CGACTTGGAATAGTTGCCGT. Outer Right Sequence: ACCACCCTATGTTCTGTGCC. Inner Left Sequence: GTGAACCGCATGAAGAGACA. Inner Right Sequence: GTTTGGTGCGATGGAACTCT. Inner primer WT PCR product: 2568. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.17. Homozygous. Outer Left Sequence: AATTTCCAGACATGATGGGC. Outer Right Sequence: GCAATACGACTTGCCAGTGA. Inner Left Sequence: GCAGCCACACTTTATGAGCA. Inner Right Sequence: AAAGGTGCCAAATGAAATGG. Inner primer WT PCR product: 2902. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58B3.8. Homozygous. Outer Left Sequence: ATTGGTGTCGCTTTCCTTTG. Outer Right Sequence: TGTACGGGTTCGAACATTCA. Inner Left Sequence: TCTGCATGTGGGAAGACGTA. Inner Right Sequence: GAGGCAATGGTCAGAGAAGC. Inner primer WT PCR product: 2708. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23H5.3. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2596. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56D6.11&F56D6.21. Homozygous. Outer Left Sequence: TACGGGCCTCTGTCAATTTC. Outer Right Sequence: TCGTCGTGATTGTGTTGGTT. Inner Left Sequence: GCTCTCTTCCAAATGGCAAC. Inner Right Sequence: ATTCGGTGGCAAAAGTCAAG. Inner primer WT PCR product: 3169. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23H5.3, C23H5.8. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2595. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03D2.5, W03D2.3. Homozygous. Outer Left Sequence: GCGGTTTTTAATGGGGAAAT. Outer Right Sequence: TGAGAAGGAAGGATGATGGG. Inner Left Sequence: AACTGAGGCCTGGAGTTTGA. Inner Right Sequence: CAGCCTTTTTGGAGAGCTTG. Inner primer WT PCR product: 2763. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33H5.4. Homozygous. Outer Left Sequence: CACACACCGAGACTGACGA. Outer Right Sequence: TTGATTCTCAGCCAGGCTCT. Inner Left Sequence: TAAATTAGCGATGCCCGAA. Inner Right Sequence: TTCTTCTTGTGCCTGCATTG. Inner primer WT PCR product: 2678. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30H6.6. Homozygous. Outer Left Sequence: CACCCCTGTCACAGACCTTT. Outer Right Sequence: CGCCAGAGAACAACAGATG. Inner Left Sequence: TGGGCACAAGTTTCATGGT. Inner Right Sequence: AATTTTCTCGCCCTCCAGAT. Inner primer WT PCR product: 2412. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09E10. Homozygous. Outer Left Sequence: ATTTGCCGTCAAAACTGACC. Outer Right Sequence: TACATTGTTGCCCACTGCAT. Inner Left Sequence: TGCAGCTGATCGTTTCATTC. Inner Right Sequence: TGCAGGTGTGAAGTGGACTC. Inner primer WT PCR product: 3420. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44B12.7. Homozygous. Outer Left Sequence: GGTCAGCGGTGTAACTTGGT. Outer Right Sequence: CATAACCGGGATATCGGATG. Inner Left Sequence: TCAAGTTGCCGGAAGTTTTT. Inner Right Sequence: TGAATAAAGCCTCCCAGTCG. Inner primer WT PCR product: 2120. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y76B12C.2. Homozygous. Outer Left Sequence: ATTGGCAAAAGGTGAACGTC. Outer Right Sequence: CAGTTTCAAAGCATTTCGCA. Inner Left Sequence: CGGAAGATGAATGGGAAGAA. Inner Right Sequence: GACAAGCGACTCGTCTAGGG. Inner primer WT PCR product: 2715. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36H8.1. Homozygous. Outer Left Sequence: GTGAAACCGATTTTGATGGG. Outer Right Sequence: GCGCGAGATGCTCTTTTATT. Inner Left Sequence: ATTTTGCACAACATAGGCCC. Inner Right Sequence: CCCTACTCGGATTCGTCAAA. Inner primer WT PCR product: 2103. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK809.4. Homozygous. Outer Left Sequence: ACGACCGTGGTAATCGAAAG. Outer Right Sequence: ACCATTCAGGTTCAGGTTGC. Inner Left Sequence: GGAGAACAACGAGATGGTGC. Inner Right Sequence: GCAAAAGTAGGCGGAGTTTG. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30H6.2. Homozygous. Outer Left Sequence: AAATAATGGCGGCTCATTTG. Outer Right Sequence: GAACAGAGCCATACCGTCGT. Inner Left Sequence: CACGACGGTCAAGGAGTTTT. Inner Right Sequence: CTATTCCTCCCACCCCAATC. Inner primer WT PCR product: 2209. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2024.3 Homozygous. Outer Left Sequence: CATTGTTTTGTCGCCTCCTT. Outer Right Sequence: GCCTCTGATGATTAGCCGAA. Inner Left Sequence: ATCGACAACATGGATGCAAA. Inner Right Sequence: ACACAAATCGTCTCTTCCGC. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37A1B.17 Homozygous. Outer Left Sequence: TTTGAACGAAAGAAGTGGGG. Outer Right Sequence: CCAACACGCACTTTTCATGT. Inner Left Sequence: CCTATCGATCCTTCAAGCCA. Inner Right Sequence: GTCTCTGGCTGGTCTATCGC. Inner Primer PCR Length: 2242. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C12.4. Homozygous. Outer Left Sequence: CACGATTTGCTGTGTACGCT. Outer Right Sequence: AGAACGACGAATTCATTGGC. Inner Left Sequence: CAACAATCCAACAACAACGC. Inner Right Sequence: GTTTTTCACCAGCGTGGAAT. Inner Primer WT PCR Product: 3273. Deletion size: 842 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11G6.8. Homozygous. Outer Left Sequence: GCCATCATGTCGATGTCAAA. Outer Right Sequence: CAGCGAATTTTTGCGATTTT. Inner Left Sequence: CCGGAAAAATTGGGAAGATT. Inner Right Sequence: GAAAATTCCGCTGAGACGAG. Inner Primer PCR Length: 3163. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35G2.4 Homozygous. Outer Left Sequence: GCAGGTACGCAGGCATTTAT. Outer Right Sequence: TTCAACATCCGTTCCACGTA. Inner Left Sequence: GTTGCAGGGCTCTTGCTTAC. Inner Right Sequence: TCCCTCTTCATCATCATCCC. Inner Primer PCR Length: 3083. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19B6.4 Homozygous. Outer Left Sequence: GTGCCTCATTAAGCAATCGG. Outer Right Sequence: ATCATTTGGCGCAGAAAATC. Inner Left Sequence: CCCCACTCAAAAGTCACGAT. Inner Right Sequence: GGCCACAGTTCGATCTCATT. Inner Primer PCR Length: 3307. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11B7.4&T11B7.5. Homozygous. Outer Left Sequence: TCCACCACAAGGTTTCAACA. Outer Right Sequence: GGACACGTGATTGTGATTGC. Inner Left Sequence: TCTTAGGTTTGGGGCAGTTG. Inner Right Sequence: GTTGTTGGCTTTGATTCCGT. Inner Primer WT PCR product: 2157. Deletion size: 1236 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07C6.4b. Homozygous. Outer Left Sequence: TGATTGACTTGCTGCTGACC. Outer Right Sequence: AGGGTAAAGGAAGGGCTCAA. Inner Left Sequence: CCTGTGCGTTTTTGGTTTTT. Inner Right Sequence: CAGGAGGATGGAGCATTGAT. Inner Primer WT PCR product: 2719. Deletion size: 2238 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02A2.1. Homozygous. Outer Left Sequence: ATGTGATGTGATGCTGGGAA. Outer Right Sequence: TTGCTTTCTTTCGGCAAACT. Inner Left Sequence: CAATGCACCATATTTCACGC. Inner Right Sequence: ATCAGAAATTTGCCGGTTTG. Inner Primer WT PCR product: 2728. Deletion size: 1224 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12A7.1. Homozygous. Outer Left Sequence: TGAACGCTGACCTGAGTTTG. Outer Right Sequence: ATCATATTCGTCTGGCGGAG. Inner Left Sequence: GACGCGATTTGTAGCCTAGC. Inner Right Sequence: GTCTCTTTGCCATGGATCGT. Inner Primer WT PCR product: 3269. Deletion size: 1719 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55F3AM.6. Homozygous. Outer Left Sequence: GTCGCATTTCCGTTCATTTT. Outer Right Sequence: ACGTCTCATTACGGGATTCG. Inner Left Sequence: AAATGCCACGTCATGAAACA. Inner Right Sequence: TTTGGGTCCAGAAAAGCAAG. Inner Primer WT PCR product: 2766. Deletion size: 1184 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26H9A.2. Homozygous. Outer Left Sequence: ATGTCGAAAATGCCCAAAAC. Outer Right Sequence: AAGTCTGAACCAGGGGTGTG. Inner Left Sequence: CCCTGAGCGAGCACTTATTC. Inner Right Sequence: CGTGTTCAAAACTGCAAGGA. Inner Primer WT PCR Product: 2824. Deletion size: 1250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73F8A.25. Homozygous. Outer Left Sequence: AAAGTTGCAGTGGGGAAATG. Outer Right Sequence: AAGCGAATACGGATCATTGG. Inner Left Sequence: TTTCACGGAATTCTGGCTTC. Inner Right Sequence: TCTGAGCAAATTTTCCGCTT. Inner Primer WT PCR Product: 2305. Deletion size: 920 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

mTagRFP-T tag inserted into endogenous pgl-1 locus. Red fluorescence in P granules. Reference: Schreier J, et al. Nat Cell Biol. 2022 Feb;24(2):217-229. doi: 10.1038/s41556-021-00827-2. PMID: 35132225

HA tag inserted into endogenous tofu-2 locus. Tagged TOFU-2 appears to be fully functional. Reference: Podvalnaya N, et al. bioRxiv 2023.01.19.524756; doi: https://doi.org/10.1101/2023.01.19.524756.

HA tag inserted into endogenous tofu-2 locus. Tagged TOFU-2 is expressed at wild-type levels, but catalytically dead. No 21U RNAs produced. Reference: Podvalnaya N, et al. bioRxiv 2023.01.19.524756; doi: https://doi.org/10.1101/2023.01.19.524756.

Mild 21U RNA defect. Reference: Podvalnaya N, et al. bioRxiv 2023.01.19.524756; doi: https://doi.org/10.1101/2023.01.19.524756.

Mild 21U RNA defect. Reference: Podvalnaya N, et al. bioRxiv 2023.01.19.524756; doi: https://doi.org/10.1101/2023.01.19.524756.

No 21U RNAs produced. Reference: Podvalnaya N, et al. bioRxiv 2023.01.19.524756; doi: https://doi.org/10.1101/2023.01.19.524756.

slfl-3(xf356) is an in-frame deletion of the SLFL-3 trans-membrane domain. 50-80% loss of 21U RNAs. Reference: Podvalnaya N, et al. bioRxiv 2023.01.19.524756; doi: https://doi.org/10.1101/2023.01.19.524756.

Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.